The largest database of trusted experimental protocols

5 protocols using ab7760

1

Characterization of Pancreatic Endocrine Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were seeded at a density of 1X105 /well on an 8-well chamber slide and fixed in 4% paraformaldehyde (PFA) in PBS for 20 min at RT. Then the cells were permeabelized using 0.2% Triton X-100 for 5 min at room temperature and incubated overnight with primary antibody at 4°c. The primary antibodies were mouse anti-human insulin (1:100) (# ab7760, Abcam, Cambridge, MA, UK), mouse anti-human Glucagon (1:200) (#ab10988), mouse anti-human PDX1 (1:200) (#ab84987) and mouse anti-human Neurogenin3 (1:100) (#ab87108). After washing with PBST 3 times, the slides were incubated with fluorescence-labeled secondary antibody, including FITC-coupled goat anti-mouse IgG (1:50) (#AF8032, Razi Biotech, Iran) and Texas Red-labeled goat anti-mouse IgG (1:100) (ab5884) for 45 min at RT away from dark. Nuclear DNA was stained with 0.1μg/ml of blue-fluorescent 4', 6-Diamidino-2-phenylindole (DAPI) (Sigma) at 30°C for 5 min after washing with PBST 3 times. The slides were mounted with glycerol-PBS and visualized under a fluorescence microscope (Nikon.US). All experiments were repeated at least two times. In addition, pancreatic endocrine markers checked by western blot analysis.
+ Open protocol
+ Expand
2

Immunocytochemical Analysis of Pancreatic Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
For immunocytochemical analysis, differentiated cells were scraped at day 21 and cells were washed twice in cold 2% FBS-PBS, then diluted in 100 ml of cold 1% bovine serum albumin in phosphate-buffered saline (BSA-PBS). 105 cells were fixed on slides by cytocentrifugation (Shandon Cytospin, USA). Cells were coated on the slides and fixed with 4% paraformaldehyde (PFA, Merck, Germany) for 20 minutes at room temprature. Then, cells were permeabilized with 0.2% Triton (Merck, Germany) 100-X for 5 minutes. Slides were washed twice and incubated in 5% goat serum for 45 minutes. The primary antibody were mouse anti-human insulin (1:100# ab7760, Abcam, Cambridge, MA, USA), mouse anti-human Neurogenin3 (1:100# ab87108 Abcam, Cambridge, MA, USA) and mouse anti-human PDX1 (1:200#ab84987 Abcam, Cambridge, MA, USA). Cells were washed 3 times with PBS with Tween 20 (PBST) and incubated for 45 minutes at room temperature with fluorescence-labeled secondary antibody, including fluorescein isothiocyanate (FITC)-labeled goat anti-mouse IgG (1:50, #AF8032, Razi Biotech, Iran) and Texas red-labeled goat anti-mouse IgG (1:100, #ab5884). Nuclear DNA was stained with 0.1 μg/ml of blue-fluorescent 4΄, 6-Diamidino-2-phenylindole (DAPI, Sigma, USA) at 30˚C for 5 minutes. The slides were visualized under a fluorescence microscope (Nikon, USA).
+ Open protocol
+ Expand
3

Quantifying Pancreatic Insulin Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Isolated mouse pancreata were fixed using Mildform (Wako) overnight at 4°C and embedded in paraffin (Sakura Finetek Japan). Sections of 4 μm were treated with 0.2% Triton-X100/PBS for 5 min and incubated with boiled 0.01 M citrate buffer, pH 6.0, for 20 min. Prior to application of primary antibody, sections were treated with Blocking Solution A from the Histofine MOUSESTAIN kit (Nichirei). Primary antibodies, including anti-OPG rabbit polyclonal antibody at 5.0 μg/ml (ab73400, abcam), anti-insulin mouse monoclonal antibody IN-05 at 1.0 μg/ml (ab7760, abcam), and anti-glucagon mouse monoclonal antibody K79bB10 at 4.4 μg/ml (ab10988, abcam) were applied overnight at 4°C. After washing with PBS, cells were stained with Alexa 488-conjugated goat anti-mouse IgG or Alexa 594-conjugated goat anti-rabbit IgG (Molecular Probes) for 1 hr at room temperature. After washing, sections were mounted with Vectashield mounting medium with DAPI (Vector Laboratories) and observed under an LSM710 confocal fluorescence microscope (Carl Zeiss) to determine signal localization or under a DMi6000B microscope (Leica) to measure signal intensity. The average signal intensity was measured by freehand region of interest (ROI) using Tissue Studio (Definiens) software to quantify insulin expression levels in pancreatic β-cells.
+ Open protocol
+ Expand
4

Native ChIP-qPCR for Histone Modifications

Check if the same lab product or an alternative is used in the 5 most similar protocols
Native chromatin immunoprecipitation was performed by following a previously published protocol (20 (link)). In brief, native chromatin prepared from 5 − 10 × 106 cells was digested with micrococcal nuclease (Worthington) and subjected to immunoprecipitation using antibodies against H3K27ac (ab4729, Abcam) or H3K4me2 (ab7760, Abcam) coupled to Dynabeads protein G (Life Technologies). Precipitated DNA was purified and enrichment of the Cd4 regulatory regions was quantitated by real-time PCR with the following primers using a Roche LC480II and Luminaris Color SYBR green PCR reagent (Thermofisher):

Cd4Sil-F: TACGAAGCTAGGCAACAGAGGAAG,

Cd4Sil-R: TGTGGTCCCGAATGCGTTT,

Tcrb-enhancer (Eβ)-F: GCTCCATCTCCAGGAGTCAC,

Eβ-R: AAGTGTGGTTCCCAAAATGC,

DHS+3-F: AAGGAGGAAGAGCCCAATAGAG,

DHS+3-R: TGTGTCAGTCCCTGGTGAGTAG.

+ Open protocol
+ Expand
5

Immunofluorescence and Western Blot Antibodies

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following primary antibodies were used for immunofluorescence and western blot analysis: mouse monoclonal antibody against native insulin (Abcam, Cambridge, MA, ab7760), guinea pig polyclonal antibody against total insulin (preproinsulin, proinsulin and insulin) (Abcam, ab7842); mouse monoclonal anti-proinsulin (HyTest, Turku, Finland, CCI-3, specific for proinsulin and does not recognize insulin or C-peptide); rabbit monoclonal anti-glucagon (Abcam, ab92517); mouse monoclonal anti-HID-1 (Origene, Rockville, MD, TA501311) or rabbit polyclonal anti-HID-1 (Proteintech, Wuhan, China, 21174-1-AP); rabbit polyclonal anti-PC1/3 (Abcam, ab3523); rabbit polyclonal anti-PC2 (Abcam, ab3533); mouse anti-CPE (BD, San Jose, CA, 610759), rabbit polyclonal anti VAMP4 (Abcam, ab3348); mouse monoclonal anti-Synaptotagmin 4 (Abcam, ab57473). The following secondary antibodies were used: Alexa Fluor 488-conjugated goat anti-mouse; Alexa Fluor 555-conjugated goat anti-rabbit; Alexa Fluor 405-conjugated goat anti-mouse (all from Thermo Fisher, Waltham, MA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!