Abi prism 7900 instrument

Manufactured by Thermo Fisher Scientific

Sourced in United States

The ABI Prism 7900 is a real-time PCR instrument designed for quantitative gene expression analysis. It provides high-throughput screening capabilities and can simultaneously detect and quantify multiple targets in a single sample.

Automatically generated - may contain errors

Lab products found in correlation

Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Rneasy mini kit, by Qiagen (1 mentions) Iscript advanced cdna synthesis kit, by Bio-Rad (1 mentions) Sybr green premix ex taq, by Takara Bio (1 mentions) Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions) Sybr premix ex taq 2 reagent, by Takara Bio (1 mentions) Primescript rt reagent kit, by Takara Bio (1 mentions) Abi 7500 real time pcr, by Thermo Fisher Scientific (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

ABI PRISM 7900 Sequence Detection System instrument ABI Prism 7900 real-time PCR instrument ABI Prism 7900 HT SDS instrument ABI PRISM 7900 HT Fast Real-Time instrument ABI Prism 7900 ABI 7900 instrument Prism 7900 ABI 7900

7 protocols using abi prism 7900 instrument

Quantitative PCR Analysis of Intestinal Barrier Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was isolated from cells using the RNeasy Mini Kit (Qiagen, Barcelona, Spain), following the manufacturer’s recommendations. Complementary DNA (cDNA) was synthesized using the iScript advanced cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA, USA). cDNA was amplified with SYBR Green PCR Master Mix (Applied Biosystems, Glasgow, UK) and an ABI Prism 7900 instrument (Applied Biosystems, Foster City, CA, USA).
The specific primers used were: TLR4, assay ID: qHsaCED0037607; IL-6, Assay ID: qHsaCED0044677; and occludin, assay ID: qHsaCED0038290 (Bio-Rad, Coralville, IA, USA). q-PCR data were normalized to the β-actin gene (assay ID: qHsaCED0036269). The PCR conditions were 1 cycle of 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The 2^−∆∆Ct method was used for relative quantification. Changes in gene expression were expressed as fold change versus unstimulated Caco-2 cells.

Álvarez-Mercado A.I., Plaza-Díaz J., de Almagro M.C., Gil Á., Moreno-Muñoz J.A, & Fontana L. (2022). Bifidobacterium longum subsp. infantis CECT 7210 Reduces Inflammatory Cytokine Secretion in Caco-2 Cells Cultured in the Presence of Escherichia coli CECT 515. International Journal of Molecular Sciences, 23(18), 10813.

+ Open protocol

+ Expand

Quantifying IGF-1R mRNA Expression in HCC

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from both HCC and adjacent normal tissue specimens adopting TRIzol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. Then total RNA was reversely transcribed into the 1st-strand of cDNA using the RevertAid First Strand cDNA synthesis kits (Fermentas) according to the manufacturer's protocol. Quantitative real-time polymerase chain reaction (qRT-PCR) reaction was performed using a SYBR Green Premix Ex Taq (Takara, Japan) on an ABI Prism 7900 instrument (Applied Biosystems, Foster City, CA). Relative expression of IGF-1R mRNA was calculated employing the comparative 2^−ΔΔCt (threshold) method. GADPH was used as internal control. Primer sequences were as follows: IGF-1R forward: 5′-GTACAACTACCGCTGCTGGA-3′, and reverse: 5′-TGGCAGCACTCATTGTTCTC-3′; GADPH: forward: 5′-TCTTCGCTTTGTCCTTTCGT-3′, and reverse: 5′-TGCTGTAGCCAAATTCGTTG-3′. All experiments were performed in triplicate.

Zhang Z., Lei B., Chai W., Liu R, & Li T. (2019). Increased expression of insulin-like growth factor-1 receptor predicts poor prognosis in patients with hepatocellular carcinoma. Medicine, 98(44), e17680.

+ Open protocol

+ Expand

Quantitative Analysis of Aquaporin Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation was followed by the reverse transcriptase PCR method. Reverse transcription into complementary DNA was achieved using the reagents and protocol of the PrimeScript RT reagent kit (TaKaRa BIO, Kyoto, Japan). The PCR primer set was as follows: mouse Aqp4 primers, forward; 5′-CTT TCT GGA AGG CAG TCT CAG-3′, reverse; 5′-CCA CAC CGA GCA AAA CAA AGA T-3′, mouse Aqp5 primers, forward; 5′-GGG TAA CCT GGC CGT CAA TG-3′, reverse; 5′-TGA CCG ACA AGC CAA TGG ATA A-3′, and mouse Gapdh primers, forward; 5′-TGT GTC CGT CGT GGA TCT GA-3′, reverse; 5′-TTG CTG TTG AAG TCG CAG GAG-3′. Real-time PCR was performed using SYBR Premix Ex Taq II reagent (TaKaRa BIO Inc.) and an ABI PRISM 7900 instrument (Applied Biosystems, Lincoln, CA, USA). Relative gene expression was calculated using the comparative delta Ct method with the Ct values of the housekeeping gene, Gapdh. mRNA levels were normalized, with the percentage for control groups taken as 100%.

Nakamachi T., Ohtaki H., Seki T., Yofu S., Kagami N., Hashimoto H., Shintani N., Baba A., Mark L., Lanekoff I., Kiss P., Farkas J., Reglodi D, & Shioda S. (2016). PACAP suppresses dry eye signs by stimulating tear secretion. Nature Communications, 7, 12034.

+ Open protocol

+ Expand

IGF2BP2 rs4402960 Genotyping Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

About 5 ml blood sample was collected from each participant. DNA was extracted with standard proteinase K digestion, followed by phenol–chloroform extraction and ethanol precipitation.
Genotyping of IGF2BP2 rs4402960 was performed with the Taqman allelic discrimination assays using ABI 7500 Real Time PCR (Applied Biosystems, Foster City, CA). All primers and probes were designed by Applied Biosystems (Foster City, CA). The primers sequence were 5′-GGAGCAGTAAGGTAGGATGGACAGTAGATT-3′ (forward) and 5′-AAGATACTGATTGTG TTTGCAAACATGCCC-3′ (reverse). Assay ID is C__2165199_10, and context sequence is AGTAAGGTAGGATGGACAGTAGATT[G/T]AAGATACTGATTGTGTTTGCAAACA. The reaction mix included 10 μl DNA, 25 μl master mix (Applied Biosystems), 2.5 μl probe, and 12.5 μl sterile water in a final volume of 50 μl. PCR conditions comprised an initial denaturing step at 95°C for 10 min, followed by 45 cycles of 92°C for 30 s, with a final extension at 60°C for 1 min. PCR plates were read on an ABI PRISM 7900 instrument (Applied Biosystems). Two authors (G.S. and G.Z.) independently reviewed the genotyping results and input data.

Liu J., Song G., Zhao G, & Meng T. (2020). Lack of association between IGF2BP2 rs4402960 polymorphism and gestational diabetes mellitus: a case–control study, meta-analysis and trial sequential analysis. Bioscience Reports, 40(7), BSR20200990.

+ Open protocol

+ Expand

Genotyping of Autophagy-related SNPs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The selection of candidate SNPs were mainly based on study previously published by Wen et al. (2018). Eight of the nine functional SNPs [ATG2B rs17784271 (3ʹUTR) and rs4900321 (3ʹUTR); ATG10 rs10514231 (intron 2), and rs4703533 (the promoter region); ATG12 rs26538 (the promoter region) and rs1058600 (3ʹUTR); ATG16L2 rs1126205 (the promoter region) and rs10898880 (the promoter region)], were included (MAF of rs6884232 in Chinese was 0). We also included two widely reported SNPs in ATG10 gene, rs1864182 and rs1864183. This means totally 10 SNPs were included in this study. The genotyping was performed using the TaqMan methodology and read with the Sequence Detection Software on an ABI‐Prism 7,900 instrument according to the manufacturer's instructions (Applied Biosystems, Foster City, CA).

Yang Z, & Liu Z. (2019). Potentially functional variants of autophagy‐related genes are associated with the efficacy and toxicity of radiotherapy in patients with nasopharyngeal carcinoma. Molecular Genetics & Genomic Medicine, 7(12), e1030.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA (1 μg), extracted as above, was reverse transcribed using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems). The resulting cDNA was diluted to 5 ng/μl and 2 μl were used in each qPCR using the SYBR Green PCR Master Mix protocol and reagents (Applied Biosystems). qRT-PCR was performed by using a ABIPRISM7900 Instrument (Applied Biosystems) using the primers listed in S7 Table. All reactions were performed in three replicates from two independent cultures. As a control, we used Pros_5693, encoding sigma-70.

Tocchetti A., Bordoni R., Gallo G., Petiti L., Corti G., Alt S., Cruz J.C., Salzano A.M., Scaloni A., Puglia A.M., De Bellis G., Peano C., Donadio S, & Sosio M. (2015). A Genomic, Transcriptomic and Proteomic Look at the GE2270 Producer Planobispora rosea, an Uncommon Actinomycete. PLoS ONE, 10(7), e0133705.

+ Open protocol

+ Expand

Human EMT RT² Profiler PCR Array

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Human EMT RT² Profiler™ PCR array was performed by KangChen Bio-tech (Shanghai, People’s Republic of China). Briefly, RNA from cells (A-375 and 1205Lu) was extracted by using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. qRT-PCR array was done using Super Array PCR master mix on an ABI PRISM7900 instrument (Applied Biosystems, Foster City, CA, USA), and the expression levels were calculated by using 2^−ΔΔCT method.

Shi G., Li H., Gao F, & Tan Q. (2018). lncRNA H19 predicts poor prognosis in patients with melanoma and regulates cell growth, invasion, migration and epithelial–mesenchymal transition in melanoma cells. OncoTargets and therapy, 11, 3583-3595.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!