E coli arcticexpress de3 cells

Manufactured by Agilent Technologies

Sourced in United States

The E. coli ArcticExpress (DE3) cells are a specialized strain of Escherichia coli bacteria designed for the expression of recombinant proteins. These cells are engineered to facilitate the production of proteins that may be difficult to express in standard E. coli strains, particularly at lower temperatures.

Automatically generated - may contain errors

Lab products found in correlation

Talon resin, by Takara Bio (2 mentions) Pcal n flag, by Agilent Technologies (2 mentions) Calmodulin sepharose, by GE Healthcare (2 mentions) Goat anti mouse hrp conjugated secondary, by Thermo Fisher Scientific (1 mentions) Bl21 de3 cells, by Thermo Fisher Scientific (1 mentions) E coli stellar cells, by Takara Bio (1 mentions) E coli dh5α cells, by New England Biolabs (1 mentions) Ni nta fast start kit, by Qiagen (1 mentions)

5 protocols using e coli arcticexpress de3 cells

Purification and Characterization of HPV-16 E2 Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

An Escherichia coli (E. coli)‐optimized synthetic gene encoding the E2 ORF from HPV‐16 was cloned into pCAL‐N‐FLAG (Agilent Technologies) containing an N‐terminal calmodulin bind site (CBS). CBS‐E2 and TAT‐CaM were expressed and purified as previously described with slight modifications.²² Briefly, CBS‐E2 was expressed in ArcticExpress (DE3) E. coli cells (Agilent Technologies) and purified by fast protein liquid chromatography using Calmodulin‐Sepharose (GE Healthcare). TAT‐CaM was expressed in BL21(DE3)pLysS E. coli cells (Agilent Technologies) and purified to near‐homogeneity by metal‐affinity chromatography using TALON resin (Takara Bio). After purification, protein constructs were dialyzed into calcium‐containing binding buffer (10 mM HEPES, 150 mM NaCl, 2 mM CaCl₂, 10% glycerol pH 7.4), sterilized via syringe‐driven filtration through a 0.22 μm filter, flash frozen in liquid nitrogen and stored at −80°C until use. Samples were collected at each stage of the purification process in 2% SDS buffer and subjected to gel electrophoresis as previously described.²⁷ Elutions were further subjected to immunoblot analysis as previously described using an HPV 16 E2 monoclonal primary antibody TVG 621 (ThermoFisher) and goat anti‐mouse HRP conjugated secondary (ThermoFisher).²⁷

LeCher J.C., Didier H.L., Dickson R.L., Slaughter L.R., Bejarano J.C., Ho S., Nowak S.J., Chrestensen C.A, & McMurry J.L. (2023). Utilization of a cell‐penetrating peptide‐adaptor for delivery of human papillomavirus protein E2 into cervical cancer cells to arrest cell growth and promote cell death. Cancer Reports, 6(5), e1810.

+ Open protocol

+ Expand

Purification of E2 and TAT-CaM Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

An E. coli-optimized synthetic gene encoding the E2 ORF from HPV-16 (GenBank: AAD33255.1) was cloned into pCAL-N-FLAG (Agilent Technologies, CA, USA), which contains a vector-encoded N-terminal calmodulin bind site (CBS). CBS-E2 and TAT-CaM were expressed and purified as previously described with slight modifications [27] . Briefly, CBS-E2 was expressed in ArcticExpress (DE3) E. coli cells (Agilent Technologies, USA) and purified by fast protein liquid chromatography using Calmodulin-Sepharose (GE Healthcare, USA). TAT-CaM was expressed in BL21(DE3)pLysS E. coli cells and purified to near-homogeneity by metalaffinity chromatography using TALON resin (Takara Bio, USA). After purification, proteins were dialyzed into calcium-containing binding buffer (10 mM HEPES, 150 mM NaCl, 2 mM CaCl 2 , 10% glycerol pH 7.4), sterilized via syringe-driven filtration through a 0.22 µm filter, flash frozen in liquid nitrogen and stored at -80°C until use.

LeCher J.C., Didier H.L., Dickson R., Slaughter L.R., Bejarano J.C., Ho S., Nowak S.J., Chrestensen C.A., & McMurry J.L. (2020). Utilization of a cell-penetrating peptide-adaptor for delivery of HPV protein E2 into cervical cancer cells to arrest cell growth and promote cell death.

+ Open protocol

+ Expand

Enzymatic Halogenation of Organic Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols

All reagents and enzyme substrates were purchased from commercial suppliers and used without additional purification. Peroxidase from horseradish (Type VI-A), β-nicotinamide adenine dinucleotide dipotassium salt (NAD), flavin adenine dinucleotide disodium salt (FAD) and sequencing primers were purchased from Sigma Aldrich (UK). The RebH gene was amplified from the genomic DNA of Lechevalieria aerocolonigenes using primers 5′–GTACGTCATATGTCCGGCAAGATTGACAAG–3′ and 5′–GTCAGCAAGCTTTCAGCGGCCGTGCTGTGCC–3′with NdeI and HindIII restriction sites. The gene was cloned into the corresponding restriction sites of pET28a.28 (link) The flavin reductase (Fre) gene was amplified from the genomic DNA of E. coli BL21 (DE3) using primers 5′–AAAAAAGGTACCATGACAACCTTAAGCTGTAAA–3’ and 3′–AAAAAACTCGAGTCAGATAAATGCAAACGCATC–5′, and digested using KpnI and XhoI before ligating into the pET45b expression vector. The pET21b/GDH2 plasmid24 (link) was a kind gift from Prof. N. S. Scrutton’s laboratory. All vectors were confirmed by DNA sequencing. E. coli ArcticExpress (DE3) cells were purchased from Agilent and BL21(DE3) cells were purchased from Invitrogen. Details of halogenase enzyme production, enzymatic halogenation and assay analysis can be found in the Supporting Information.

Hosford J., Shepherd S.A., Micklefield J, & Wong L.S. (2014). A High-Throughput Assay for Arylamine Halogenation Based on a Peroxidase-Mediated Quinone–Amine Coupling with Applications in the Screening of Enzymatic Halogenations. Chemistry (Weinheim an Der Bergstrasse, Germany), 20(50), 16759-16763.

+ Open protocol

+ Expand

Monoterpenoid Production in E. coli

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

All E. coli strains were routinely grown in Lysogeny Broth (LB) or on LB agar plates including antibiotic supplements as appropriate (carbenicillin, 100 μg ml^-1; kanamycin, 50 μg mL^-1). Cloning, mutagenesis and plasmid propagation was performed using E. coli Stellar cells (Takara Bio), in vivo production of monoterpenoids was performed using E. coli DH5α cells (New England Biolabs), and recombinant protein production was performed using E. coli Arctic Express (DE3) cells (Agilent).
Synthetic genes encoding native FenS, LimS and PinS, without plastidial signal sequences were codon optimised for expression in E. coli and sub-cloned into the NcoI-XhoI restriction sites of pETM-11 fused to a Tobacco Etch Virus (TEV) protease cleavable N-terminal His₆-tag (GeneArt, Life Techonologies)3 (link). The resulting pseudo-mature constructs, truncated at the RRX₈W motif30 (link)–31 (link), are shown in Table S1 of the Supporting Information. For in vivo production of monoterpenoids the genes were re-cloned into a BglBrick vector32 (link) containing a geranyl diphosphate synthase (GPPS) from Abies grandis (pBb-GPPS-mTC/S series) and co-transformed with pVMA, containing the bacterial/yeast hybrid MVA pathway, as described previously3 (link). A list of all plasmids used in this study is shown in Table S2 of the Supporting Information.

Leferink N.G., Ranaghan K.E., Karuppiah V., Currin A., van der Kamp M.W., Mulholland A.J, & Scrutton N.S. (2018). Experiment and Simulation Reveal How Mutations in Functional Plasticity Regions Guide Plant Monoterpene Synthase Product Outcome. ACS catalysis, 8(5), 3780-3791.

+ Open protocol

+ Expand

Synthetic Peptide for S. mansoni Protein

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

A synthetic peptide (SLPSNAHNNDNNSSD-biotin) containing amino acids 216–230 from the S. mansoni protein Smp150390.1 (Carvalho et al., 2017 (link)) was purchased from Biomatik (Ontario, Canada) and conjugated with biotin at the C-terminal end. The synthetic peptide had a purity of 96.22% and was resuspended in ultra-pure water to a final concentration of 2.5 mg/ml and stored at-70°C until use. A S. mansoni recombinant protein, called by the name PPE (rPPE), and encoded by a sequence similar to the Smp_049300.3 gene, was expressed in E. coli ArcticExpress (DE3) cells (Agilent Technologies, Santa Clara, CA, United States) using the pET21a plasmid and purified by Ni²⁺ affinity chromatography using the Ni-NTA Fast Start Kit (Qiagen GmbH, Hilden, Germany). The resulting purified rPPE was stored at-70°C in PBS at 1 mg/ml until use.

Mesquita S.G., Caldeira R.L., Favre T.C., Massara C.L., Beck L.C., Simões T.C., de Carvalho G.B., dos Santos Neves F.G., de Oliveira G., de Souza Barbosa Lacerda L., de Almeida M.A., dos Santos Carvalho O., Moraes Mourão M., Oliveira E., Silva-Pereira R.A, & Fonseca C.T. (2022). Assessment of the accuracy of 11 different diagnostic tests for the detection of Schistosomiasis mansoni in individuals from a Brazilian area of low endemicity using latent class analysis. Frontiers in Microbiology, 13, 1048457.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!