Plasmids pGL‐2020, pGL‐1000, pGL‐500, pGL‐121 and pGL‐121∆ISRE were constructed by cloning the PCR‐amplified fragment of the TRIM14 promoter into pGL3‐basic (Promega, Madison, WI, USA), and the primers are listed in Table 1 . pGL‐500 mutants were constructed using a site‐directed mutagenesis kit (Toyobo, Osaka, Japan), and the primers used are listed in Table 1 . Plasmids IRF‐1, IRF‐2, IRF‐3, IRF‐5 and IRF‐7 were constructed by inserting the coding sequence into the pCDNA3.1 (+) (Thermo Fisher Scientific, Waltham, MA, USA) or pCMV‐Tag3B (Agilent, Santa Clara, CA, USA) vector. The shRNA constructs for IRF‐1 and IRF‐2 were constructed using the pSIREN‐RetroQ vector (Clontech, Mountain View, CA, USA). The target sequence for IRF‐1 was: 5′‐GGGGTACCTACTCAATGAACCT‐3′; and for IRF‐2: 5′‐GGGGTACCTACTCAATG‐AACCT. Sequences of all of the constructs were confirmed by sequencing. Antibodies against IRF‐1, IRF‐2, Myc and Flag were purchased from Santa Cruz Biotechnology (Dallas, TX, USA), α‐tubulin from Sigma‐Aldrich (St. Louis, MO, USA), and TRIM14 antibody from Abcam (Cambridge, UK).
Site directed mutagenesis kit
Manufactured by Toyobo
Sourced in Japan
The Site-directed mutagenesis kit is a laboratory tool designed to introduce specific mutations into DNA sequences. It provides a set of reagents and protocols to efficiently modify target genes or plasmids, allowing for the study of the effects of specific genetic alterations.
Automatically generated - may contain errors
Lab products found in correlation
Pcdna3, by Thermo Fisher Scientific (2 mentions)
Pgl3 basic, by Promega (2 mentions)
Dual luciferase assay system, by Promega (2 mentions)
α tubulin, by Merck Group (1 mentions)
Psiren retroq vector, by Takara Bio (1 mentions)
Pcmv tag3b, by Agilent Technologies (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Dna blunting kit, by Takara Bio (1 mentions)
Ni nta agarose bead, by Qiagen (1 mentions)
Preceiver m12 vector, by GeneCopoeia (1 mentions)
Prl tk vector, by Promega (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
Pdd162 vector, by Addgene (1 mentions)
Pcfj151, by Addgene (1 mentions)
Nebuilder hifi dna assembly cloning kit, by New England Biolabs (1 mentions)
14 protocols using site directed mutagenesis kit
1
TRIM14 Promoter Cloning and Mutant Generation
2
Constructing Flavivirus DNA Vaccines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pcDNA3.1 plasmids encoding the prM–E genes of JEV (Nakayama, Beijing-1, and P3 strains) or DENV-2 were constructed as previously described [38 (link)]. Mutations (G106V and/or L107F) were then introduced into the plasmids using a site-directed mutagenesis kit (Toyobo, Osaka, Japan). Primer information is shown in Supplementary Table S1 . These plasmids were used as DNA vaccines in this study.
3
Luciferase Reporter Assay for E2F2 and B-Myb
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The promoter regions of E2F2 (−984/+329) and B-Myb (−916/+148) were obtained by PCR-based amplification and cloned into pGL3-basic and pGL4.10 vector to generate reporters, E2F2-P1314 and B-Myb-P1064, respectively. The three tandem consensus E2F binding sites were cloned into pGL4.27 [luc2P/minP/Hygro] to generate the 3 × E2F reporter. A series of luciferase reporter mutants harboring mutations in E2F and/or Myb-binding sites have been constructed by the site-directed mutagenesis kit (TOYOBO, Osaka, Japan) based on the three parental constructs of E2F2-P1314, B-Myb-P1064 and 3 × E2F reporter as described previously [39 (link)]. The pCDH-puro-HA-E2F2 expression plasmids with N terminal HA tag were constructed by amplifying the entire coding region of human E2F2 from pcDNA3.0-E2F2 (a generous gift from Prof. Chuangui Wang) and subcloning into pCDH-CMV-MCS-EF1-Puro. The sequences of primers used are listed in Supplementary Table S6 . All the constructs were validated by direct sequencing. For luciferase reporter assay, cells were seeded in triplicate into 12-well plates and co-transfected with the corresponding plasmids, and luciferase activities were measured using Dual-Luciferase assay system (Promega) as described previously [39 (link)].
4
Characterization of circ_0134944 and PDX1 Interaction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Segments of circ_0134944 and the 3′UTR of PDX1 containing miR-127-5p binding sites were synthesized by Genepharma (Shanghai, China). These fragments were linked to the luciferase reporter gene vector (Promega, Madison, WI, USA). Mutagenesis of the binding sites in circ_0134944 and PDX1 were achieved using the Site-Directed Mutagenesis Kit (Toyobo, Japan). HEK 293T cells were cotransfected with various combinations of reporter plasmids with miR-127-5p or NC or wild type/mutated circ_0134944 or PDX1 using Lipofectamine 3000 (Invitrogen, USA). 3 days later, luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega, USA). The operation method of PDX1 binding to SPHK1 promoter is the same as above.
5
Constructing Progressive Deletion Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Various progressive deletion mutants (M1-M8, M1′-M8′) were further constructed using either a DNA blunting kit (Takara, Japan) with restriction enzyme digestion and ligation, or the Site-Directed Mutagenesis Kit (TOYOBO, Japan) with reverse PCR amplification and ligation, according to the manufacturers’ instructions. Constructs with point mutation(s) at putative transcription factor binding sites were generated using Ω-PCR [49 (link)]. The primer sequences and the restriction enzymes used are listed in Supplementary Table 1 . All constructs were validated by direct sequencing, and the transient transfection assays were conducted as above.
6
Dissecting FOXP3 Ubiquitination by USP44
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assess the type of ubiquitination targeted by USP44 on the FOXP3 molecule, we generated a collection of ubiquitin lysine mutants. To this end, the 6xHis‐ubiquitin cassette was cloned into the pIP parent vector, and ubiquitin mutants were constructed using a site‐directed mutagenesis kit (Toyobo, Japan). HEK293 cells were transfected with a construct encoding MYC‐labeled FOXP3, pLVX‐USP44, and a construct encoding either a wild‐type or specific mutant ubiquitin. Transfectants were treated with 20 μM MG132 for 4 h before harvest and lysis, and a ubiquitin pull‐down assay was used to recover ubiquitinated proteins as described previously (van Loosdregt et al, 2013 ). In short, cell lysates were incubated with Ni‐NTA agarose beads (Qiagen), washed, and the presence of FOXP3 among the ubiquitinated protein fraction was visualized by immunoblot analysis after SDS–PAGE resolution.
7
Plasmid Construction for IFI44L Promoter Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids pGL‐1190, pGL‐695, pGL‐390, pGL‐274, pGL‐143, pGL‐117‐1190, pGL‐237‐1190, pGL237‐390, and pGL380‐1190 were constructed by cloning the PCR‐amplified fragment of the IFI44L promoter into pGL3‐basic (Promega, Madison, WI, USA), primers are listed in Table 1 . pGL‐274mISRE‐1 and pGL‐237‐1190mISRE‐2 were constructed using site‐directed mutagenesis kit (Toyobo, Osaka, Japan), and primers used are listed in Table 1 . Plasmids IRF‐1, IRF‐2, IRF‐3, IRF‐5, and IRF‐7 were constructed by inserting the CDS into the pCDNA3.1 (+) (Invitrogen, Carlsbad, CA, USA) or pCMV‐Tag3B (Stratagene, La Jolla, CA, USA). Sequences of all constructs were confirmed by sequencing.
Antibodies against Myc, IRF‐1, IRF‐2, Tubulin, IgG, and RNA Polymerase were purchased from Sigma (St. Louis, MO, USA), and antibody against IFI44L was purchased from Aviva (San Diego, CA, USA).
Antibodies against Myc, IRF‐1, IRF‐2, Tubulin, IgG, and RNA Polymerase were purchased from Sigma (St. Louis, MO, USA), and antibody against IFI44L was purchased from Aviva (San Diego, CA, USA).
8
Luciferase Reporter Mutagenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The luciferase reporters P202M1, P202M2, P202M3, and P202M4 were generated by a site-directed mutagenesis kit (Toyobo, Japan) on the basis of the indicated parental construct P202 (−201/+1) according to the manufacturer’s instruction. For M1 mutant, the putative Sp1 binding site of CACTCGCCGCCC ACAAC at −173 bp was changed into CACTCGCCGTAG ACAAC (underlined means changed Nucleotides). For M2 mutant, the putative Sp1 binding site of CAGAGCGGCGGGG TGGG at −126 bp was changed into CAGAGCGAATTTT TGGG. For M3 mutant, the putative Sp1 binding site of AAAGCACCGCCC CTGCGG at −64 bp was changed into AAAGCATAGAAT CTGCGG. For M4 mutant, the putative Sp1 binding site of TGCGGGGGCG TTCTCGG at −77 bp was changed into TGCGGGTTAG TTCTCGG. All of the mutations were verified by direct DNA sequencing. The primer sequences are listed in Table S1 .
9
Cloning and Characterization of Human SCN5A and SCN1B
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
This study did not involve human participants, specimens, or tissue samples, or vertebrate animals, embryos, or tissues. Use of the previously cloned human gene (SCN5A) was approved by the University of Toyama’s committee (#22–9).
Human SCN5A cDNA (GenBank: NM_198056) was subcloned into the pReceiver-M12 vector containing the N-terminal 3× FLAG epitope (GeneCopoeia, Rockville, MD, USA) to create FLAG-SCN5A(WT). FLAG-SCN5A(R1193Q) was generated from FLAG-SCN5A(WT) using a site-directed mutagenesis kit (Toyobo, Osaka, Japan). cDNA of the NaV1.5 channel beta subunit gene (GenBank: NM_001037) was subcloned into the pReceiver-M12 vector containing the N-terminal 2× Myc epitope to create Myc-SCN1B.
Human SCN5A cDNA (GenBank: NM_198056) was subcloned into the pReceiver-M12 vector containing the N-terminal 3× FLAG epitope (GeneCopoeia, Rockville, MD, USA) to create FLAG-SCN5A(WT). FLAG-SCN5A(R1193Q) was generated from FLAG-SCN5A(WT) using a site-directed mutagenesis kit (Toyobo, Osaka, Japan). cDNA of the NaV1.5 channel beta subunit gene (GenBank: NM_001037) was subcloned into the pReceiver-M12 vector containing the N-terminal 2× Myc epitope to create Myc-SCN1B.
10
Mapping p53-binding sites in ACER2 promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The putative promoter region of ACER2 was obtained by PCR-based amplification and cloned into pGL3-basic vector to generate ACER2-P1285. A series of deletion mutants were constructed using Site-Directed Mutagenesis kit (TOYOBO, Japan) according to the manufacturer’s instructions. Luciferase reporter constructs containing the indicated point mutation(s) at the potential p53-binding sites were also generated by using Site-Directed Mutagenesis kit. The sequences of primers used are listed in Supplementary Table S2 . All of the reporter constructs were validated by direct sequencing.
For luciferase reporter analysis, cells were seeded in triplicate into 12-well plates and co-transfected with the indicated reporter vectors, pRL-TK vector (Promega) encoding Renilla luciferase together with the empty vector (pcDNA3) or with pcDNA3-Flag-p53 expression vector using Lipofectamine 2000 reagent (Invitrogen). Forty-eight hours after transfection, cells were lysed and their luciferase activities were measured using Dual-Luciferase assay system (Promega) as described previously51 .
For luciferase reporter analysis, cells were seeded in triplicate into 12-well plates and co-transfected with the indicated reporter vectors, pRL-TK vector (Promega) encoding Renilla luciferase together with the empty vector (pcDNA3) or with pcDNA3-Flag-p53 expression vector using Lipofectamine 2000 reagent (Invitrogen). Forty-eight hours after transfection, cells were lysed and their luciferase activities were measured using Dual-Luciferase assay system (Promega) as described previously51 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!