First strand cdna synthesis supermix

Total RNA was extracted using the RNeasy Plant Mini Kit (TSINGKE, Beijing, China), and miRNA was extracted using miRcute (TIANGEN, Beijing, China). RNA concentration was determined using a NanoDrop spectrophotometer (Thermo Fisher Scientific). Two micrograms of total RNA were used for reverse transcription using First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China). The products were diluted 10-times, 2 μl of which was used for qPCR experiments with Green qPCR SuperMix UDG (TransGen Biotech, Beijing, China) using the Light Cycler 480 system (Bio-Rad, Foster City, USA). As previously described, stem-loop qPCR was performed for miRNA quantification (Varkonyi-Gasic et al., 2007 (link)). All experiments were repeated three times independently, with biological and technical repeats. GhUB7 was used as an internal control for coding genes, and GhU6 was used as an internal control for miRNA quantification. Relative gene expression levels of three biologically independent samples were evaluated using the 2^−ΔΔCT method (Livak and Schmittgen, 2001 (link)). Primers used in this study are listed in Supplementary Table 1.

BM-derived MDSCs were added with TRIzol reagent (Invitrogen, United States) to extract total RNA according to the manufacturer’s instruction. RNA was quantified by NanoDrop 2000 (Thermo Fisher Scientific, United States). Next, RNA was reverse transcribed into cDNA using First-Strand cDNA Synthesis SuperMix (TransGen Biotech, China). DNA amplification was detected by ABI 7500 (Applied Biosystems, United States) using SYBR Green Master Mix (Promega, United States). GAPDH was used as an internal control. The relative expression of genes was calculated using 2^−ΔΔCT. The primer sequences involved are as follows:
GAPDH-F ATG​GTG​AAG​GTC​GGT​GTG​AAC​G, GAPDH-R CGC​TCC​TGG​AAG​ATG​GTG​ATG​G, ARG1-F CTC​CAA​GCC​AAA​GTC​CTT​AGA​G, ARG1-R AGG​AGC​TGT​CAT​TAG​GGA​CAT​C, TGF-β-F GGA​CCG​CAA​CAA​CGC​CAT​CTA​T, TGF-β-R TTC​AGC​CAC​TGC​CGT​ACA​ACT​C, CEBPβ-F CAC​GAC​TTC​CTC​TCC​GAC​CTC​T, CEBPβ-R GCT​CAG​CTT​GTC​CAC​CGT​CTT​C.

Total RNA was extracted after light treatment for 0H and 16H, respectively. The mRNA was reverse transcribed into cDNA by First-Strand cDNA Synthesis SuperMix (TransGen, Beijing, China), and the product could be used as the template of Q-PCR. The reaction system was as follows: 1 μL template, 0.5 μL forward primer, 0.5 μL reverse primer, 10 μL SYBR Green, 8 μL ddH₂O. The procedure of the Q-PCR detection system (QuantStudio 1, ABI, Waltham, MA, USA) was as follows: 98 °C predenature, 94 °C denature, 74 °C anneal and extend. 18S rRNA was used as the housekeeping gene. The expression of candidate genes was obtained by calculating the 2^−ΔΔCT value.

Briefly, cells were cultured for RNA isolation using TRIzol reagent (Invitrogen, U.S.A.) following the manufacturer’s protocol. Then 1 μg total RNA was reverse transcribed to cDNA using random primers and first-strand cDNA synthesis SuperMix (TransGen Biotech, China). qRT-PCR was performed on a C1000 Thermal cycler (Bio-Rad, U.S.A.) with SYBR Green Mix (Takara Bio Inc, Japan). The primers were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd. All qRT-PCR products were verified by melting curve analysis. The real-time PCR primers were listed as follows: IL-9R forward: GTGGCCTTTCTTGTGACCAT, and reverse AGTCTCAGACAAGGGCTCCA. GAPDH forward: 5′-TGACTTCAACAGCGACACCCA-3′ and reverse: 5′- CACCCTGTTGCTGTAGCCAAA-3. The fold-relative enrichment was quantitated with normalization to the GAPDH level. Each experiment was repeated three times.