The largest database of trusted experimental protocols

48 protocols using lipofectamine 2000 transfection

1

FOXM1 Targeted siRNA Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
The small interfering RNA (siRNA) sequence targeting FOXM1 (siFOXM1) was siFOXM1 SMARTpool: ON-TARGETplus FOXM1 siRNA, L009762-00-0010 (Dharmacon, CO, USA). Transfection of siRNAs into cell lines was performed using the Lipofectamine 2000 transfection reagents (Invitrogen). Cells were transfected with siRNA or scramble siControl (1027310, Qiagen, Chatsworth, CA) at 50 ρmole for 48 h prior to subsequent analysis.
+ Open protocol
+ Expand
2

Lipofectamine 2000 Transfection and TRIZOL LS Extraction

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lipofectamine 2000 transfection and TRIZOL LS reagents were bought from Invitrogen (Grand Island, NY, USA). The DAB substrate kit has been purchased from Vector Laboratories, Inc (Burlingame, CA, USA). Abcam (Cambridge, MA, USA) provided antibodies towards SIRT4 (#: ab10140), SIRT1 (#: ab189494), H4K16ac (#: ab109463), H3K9ac (#: ab272105), Oct4 (#: ab19857), SOX2 (#: ab97959). Nanog (#: 8822), BRCA1 (#: 9010) and β-actin (#: 4970) antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA). Unless, in any other case noted, all other used chemicals were from Sigma (St. Louis, MO, USA).
+ Open protocol
+ Expand
3

miRNA Inhibitor Transfection Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
miR-510 inhibitor, miRNA inhibitor negative control (NC inhibitor), SRCIN1 siRNA, and NC siRNA were designed and purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, P.R. China). Cells were seeded into six-well plates at a density of 50% confluence. After incubation overnight, transient transfection was conducted using Lipofectamine 2000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer’s protocols. After incubating for 6–8 h, the medium was replaced by RPMI-1640 or DMEM containing 10% FBS.
+ Open protocol
+ Expand
4

Investigating ERMP1 and miR-328-3p Interactions in Hepatocellular Carcinoma

Check if the same lab product or an alternative is used in the 5 most similar protocols
ERMP1 cDNA and miR-328-3p mimics were synthesized by Molbase biological reagent company. After PCR amplification, ERMP1 cDNA was inserted into the pcDNA3.1 plasmid. Huh-7 cells and HepG2 cells were seeded in 6-well plates. After reaching 70–80% confluence, the cells were transfected with Lipofectamine 2000 transfection reagents (Invitrogen, Carlsbad, CA, USA). Upon transfection for 6 h, fresh medium was replaced. Cells were harvested at 48 h after transfection. Transfection efficiency was confirmed using RT-PCR and Western blot. Cells were performed in five groups: Control group, mimic-NC group, miR-328-3p mimic group, pcDNA-ERMP1 group, and miR-328-3p mimic + pcDNA-ERMP1 (mimic + ERMP1) group. Epithelial-mesenchymal transition (EMT) of each group cells were observed by optical microscope (Leica, Germany).
+ Open protocol
+ Expand
5

Validating miR-214-5p Binding to HCG11 and SOX4

Check if the same lab product or an alternative is used in the 5 most similar protocols
A dual-luciferase reporter gene assay was used to verify the binding association of HCG11 and SOX4 to miR-214-5p. The 3′ untranslated region (UTR) containing HCG11 or SOX4, and sequence fragments of miR-214-5p predicted binding sites, were ligated into luciferase reporter plasmids and used to co-transfect CRC cells together with miR-214-5p mimics or miR-214-5p inhibitor using Lipofectamine® 2000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc.); the imported mutant sequence fragment was used as the reference group. To determine the gene binding relationship, the dual-luciferase reporter gene system (Promega Corporation) was used to measure luciferase activity. Luciferase activity was measured 24 h after transfection and the results were normalized to Renilla luciferase activity.
+ Open protocol
+ Expand
6

N6-methyladenosine Regulatory Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lipofectamine 2000 transfection and TRIZOL LS reagents were bought from Invitrogen (Grand Island, NY, USA). The DAB substrate kit has been purchased from Vector Laboratories, Inc. (Burlingame, CA, USA). Abcam (Cambridge, MA, USA) provided antibodies towards ALKBH5, FTO, WTAP, VIRMA, RBM15, C-myc, Cyclin D1, MMP-2, MMP-9, E-cadherin, Fibronectin, Vimentin. METTL3, METTL14, WIF-1, and β-actin antibodies were got from Cell Signaling Technology (Danvers, MA, USA). Anti-α-catenin antibody was made by BD (Franklin Lakes, NJ, USA). Unless in any other case noted, all other used chemicals were from Sigma (St. Louis, MO, USA).
+ Open protocol
+ Expand
7

Silencing TPX2 in A549 Lung Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
A549 cells were purchased from the ATCC (Shanghai, China). A549 cells were cultured in Dulbecco’s modified Eagle medium (Thermo Fisher Scientific, USA) containing 10% serum (Thermo Fisher Scientific, Wilmington, DE, USA). For si-RNA transfection, A549 cells were transfected with si-TPX2 using the Lipofectamine 2000 transfection reagent (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions. To target TPX2, the following si-RNA sequences were used: AGCCTCAGAAGATCTCTTAG (si-TPX2).
+ Open protocol
+ Expand
8

Epithelial-Mesenchymal Transition Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lipofectamine 2000 transfection and TRIzol LS reagents were purchased from Invitrogen (Grand Island, NY, USA). Antibodies against Cullin7 were purchased from Abcam (Cambridge, MA, USA). E-cadherin, N-cadherin, vimentin, and β-actin antibodies were from Cell Signaling technology (Danvers, MA, USA). Anti-α-catenin antibody was from BD (Franklin Lakes, NJ, USA). Unless otherwise noted, all other chemicals were from Sigma-Aldrich (St. Louis, MO, USA).
+ Open protocol
+ Expand
9

Gallbladder Cancer Cells: Autophagy and Drug Response

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human gallbladder carcinoma cell line GBC-SD was bought from cell bank (Chinese Academy of Sciences). Each respectively, SGC-996 or GBC-SD cells was maintained in RPMI-1640 or DMEM supplemented with 10% (v/v) FBS and 1% (v/v) penicillin/streptomycin and incubated in a humidified 5% CO2 incubator at 37°C. The plasmids (GFP-LC3) or small interfering RNA (siRNA; Atg5 and Atg7) were transiently transfected into cells with Lipofectamine 2000 transfection or RNAi MAX reagent according to the manufacturer’s instructions (Invitrogen). After 24 hours, the cells were treated with 5-FU or CQ and subjected to fluorescent analysis or Western blotting assay. The SGC-996 cell line was provided by Dr. Ying-Bin Liu’s lab at Xin Hua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine, China.
+ Open protocol
+ Expand
10

Plasmid Transfection of PKM2 cDNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
We used Lipofectamine 2000 transfection reagent (Invitrogen, Carlsbad, CA) to carry out transfection of plasmids. In this work, PKM2 cDNA without carrying its 3′UTR was inserted into pcDNA3.1(+) vector to generate the recombinant pcDNA3.1(+)-PKM2 plasmid. At the same time, the pcDNA3.1(+) vector acts as control. All constructs were identified for sequence correctness using direct sequencing technology (Beijing Aodingsheng Corp., Beijing China).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!