Total RNA was extracted from fresh frozen tissues and cell lines using TRIzol Reagent (Invitrogen), and reverse transcription (RT) using ReverTra Ace qPCR RT Master Mix (Toyobo) according to the manufacturer's protocol. qPCR was performed using ABI 7900HT Sequence Detection System (Applied Biosystems, CA, USA) in the presence of SYBR-Green dye (Toyobo, Osaka, Japan). The primers were as follows: RBMS3, forward 5′-GGTAGCATCTCTCAAGGCAAAT-3′, reverse 5′-CATGTCCAAAGGGTTTCAGCA-3′; HIF1A: forward 5′-ATCCATGTGACCATGAGGAAATG-3′, reverse 5′-TCGGCTAGTTAGGGTACACTTC-3′; Glyceraldehyde-3- phosphate dehydrogenase (GAPDH) as the internal control: forward 5′-ATCAAGAAGGTGGTGAAGCAGG-3′, reverse 5′-CGTCAAAGGTGGAGGAGTGG-3′. The amplification was done in a total volume of 10 μl with the following steps: denaturation program at 95°C for 5 min, followed an amplification and quantification program for 40 cycles at 95°C for 15 s and 60°C for 45 s. All experiments were done in triplicates. A melting curve analysis was used to check the specificity of amplification. GAPDH was used as the internal control. The relative expression of each sample was calculated using the 2−ΔΔCT method.
Sybr green dye
Manufactured by Toyobo
Sourced in Japan, United States
SYBR Green dye is a fluorescent dye used in molecular biology applications, primarily for the detection and quantification of DNA in various analytical techniques such as real-time PCR and gel electrophoresis. The dye binds to double-stranded DNA, emitting a fluorescent signal that can be measured to determine the presence and amount of DNA in a sample.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Revertra ace qpcr rt kit, by Toyobo (4 mentions)
Abi 7900ht sequence detection system, by Thermo Fisher Scientific (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Abi 7300 detection system, by Toyobo (2 mentions)
Reverse transcript enzyme, by Thermo Fisher Scientific (2 mentions)
Abi pcr thermal cycler dice detection system, by Toyobo (2 mentions)
Revertra ace qpcr rt master mix, by Toyobo (1 mentions)
Recombinant human m csf, by R&D Systems (1 mentions)
Revertra ace reverse transcriptase, by Toyobo (1 mentions)
Superscript 2, by Toyobo (1 mentions)
Abi 7900ht, by Thermo Fisher Scientific (1 mentions)
7500 rt pcr system, by Thermo Fisher Scientific (1 mentions)
Faststart essential dna green master, by Roche (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
M mlv reverse transcriptase, by Toyobo (1 mentions)
Step one sequence detection system, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Lightcycler 480, by Toyobo (1 mentions)
14 protocols using sybr green dye
1
Quantitative Real-Time PCR Analysis
2
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from fresh liver samples or RAW264.7 cell samples with Trizol (Invitrogen) according to the manufacturer's instructions. Twenty nanograms of RNA was converted to cDNA using reverse transcript enzyme (Invitrogen). Quantitative RT-PCR was performed and results were analyzed using an ABI 7300 Detection System utilizing SYBR Green dye (Toyobo, Osaka, Japan). All primer sequences used for quantitative RT-PCRs are shown in Supplementary Table S1 . Relative gene expression in comparison with Gapdh expression was calculated by the comparative cycle threshold method.
3
Osteogenesis Differentiation Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
α-MEM, DMEM, and fetal bovine serum (FBS) were purchased from Hyclone (USA). StemPro Osteogenesis Differentiation Kits were purchased from Gibco (USA). Tartrate-resistant acid phosphatase (TRAP) staining kits were purchased from Beyotime (China). ELISA kits for TNF-α, TGF-β, and IL-10 were purchased from RayBiotech (USA). Human recombinant M-CSF was purchased from R&D Systems. MTB strain H37rv was provided by the China Drugs and Biological Product Analysis Institute (China). PCR primer was synthesized by Sangon (China). Real-time fluorescent PCR and SYBR Green dye were purchased from Toyobo (Japan). Rabbit anti-human nuclear factor κB receptor activator ligand (RANKL), rabbit anti-human osteoprotegerin (OPG), and mouse anti-human NFATc1 monoclonal antibody were purchased from Abcam (USA). Mouse anti-human histone H3.1 was purchased from CST (USA). Adenovirus carrying TGF-β or IL-10 (Ad-TGF-β-EGFP, Ad-IL-10-EGFP, or Ad-EGFP) was purchased from Cygene (China).
4
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from whole seeds, embryos, and embryoless half-seeds was extracted from frozen materials by the SDS/phenol/LiCl method (Chirgwin et al., 1979 (link)). cDNA was synthesized from extracted RNA with ReverTra Ace reverse transcriptase (Toyobo co., Ltd., Osaka, Japan) according to the manufacturer’s instructions. Quantitative real-time PCR was performed on a CFX Connect Optics Module Real-time PCR detector system (Bio-Rad) with SYBR Green dye (Toyobo) as described in the manufacturer’s instructions. PCR thermal cycling conditions were as follows: initial denaturation at 94°C for 2 min; 40 cycles of denaturation at 94°C for 20 s, annealing at a primer-specific temperature for 20 s (Table S1
5
Quantitative Real-Time PCR for THBS2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the second cohort using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. cDNA was synthesized by random primers and Superscript II reverse transcriptase (Toyobo, Osaka, Japan). The primers used for amplification for THBS2: forward primer 5’-CGTGGACAATGACCTTGTTG-3’ and reverse primer 5’-GCCATCGTTGTCATCATCAG-3’. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified in the same q-PCR as an internal control using primers: forward primer 5’-AGCCACATCGCTCAGACAC-3’ and reverse primer 5’-GCCCAATACGACCAAATCC-3’. The reaction ran on the ABI 7900HT Sequence Detection System (Applied Biosystems, CA, USA) in the presence of SYBR-Green dye (Toyobo, Osaka, Japan). The reaction condition was a denaturation program (95°C for 5 min), and an amplification and quantification program for 40 cycles (95°C for 15 s and 60°C for 45 s). Every sample was tested in triplicates, and a melting curve analysis of each sample was used to check the specificity of amplification. The expression level was determined as a ratio between THBS2 and the internal control GAPDH in the amounts of mRNA calculated by comparative CT method.
6
Quantifying NEDD4L and HIF-1α mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh frozen human GC tissue were used for extraction of total RNA using TRIzol Reagent from Invitrogen (USA), and reverse transcription was carried out using the ReverTra Ace qPCR RT Kit from Toyobo (Japan) as per instructions of the manufacturer. The NEDD4L and HIF-1α mRNA levels were determined by RT-PCR on the Sequence Detection System ABI 7900HT from Applied Biosystem (USA) and using SYBR-Green dye from Toyobo (Japan), and the following primers: NEDD4L, sense (5′- TCCAATGGTCCTCAGCTGTTTA -3′) and antisense (5′-ATTTTCCACGGCCATGAGA-3′); HIF-1α, sense (5′-ATCCATGTGACCATGAGGAAATG-3′) and antisense (5′-TCGGCTAGTTAGGGTACACTTC-3′); GAPDH, sense (5′-ATCAAGAAGGTGGTGAAGCAGG-3′), antisense (5′-CGTCAAAGGTGGAGGAGTGG-3′). The 2-∆∆CT method was used to estimate the fold changes in expression.
7
Quantitative PCR Analysis of Neuropathic Pain Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from DRGs and spinal cord of lumbar4-6 (L4-6) segments, sciatic nerve, and tibial nerve using Trizol Reagent (Invitrogen, Grand Island, NY, USA). The concentration of the total RNA was quantified by a Spectrophotometer (Thermo Scientific, USA). Then, cDNA was generated from 2 µg RNA using a ReverTra Ace® qPCR RT Kit (Toyobo, Osaka, Japan) according to the manufacturer’s instructions. Quantitative PCR was performed using SYBR Green dye (Toyobo, Osaka, Japan) and Applied Biosystems (7500 RT-PCR System). Expression values of the targeted genes were normalized to the corresponding expression of β-actin. The 2−ΔΔCt method was used to calculate relative expression levels of the targeted genes. Sequence-specific primers are listed in Table 1 .
![]()
List of primers used for real-time PCR.
| Gene names | Primers |
|---|---|
| NLRP3 | Sense: 5′-GAGGACCTGGAAGATGTGGA-3′ |
| Antisense: 5′-CCAAGTGATCTGCCTTCTCC-3′ | |
| Caspase-1 | Sense: 5′-ACCTGTGCGATCATGTCACT-3′ |
| Antisense: 5′-AGCTGATGGACCTGACTGAAG-3′ | |
| IL-1β | Sense: 5′-TGATGACGACCTGCTAGTGTG-3′ |
| Antisense: 5′-TCCATTGAGGTGGAGAGCTT-3′ | |
| β-actin | Sense: 5′-TGTCACCAACTGGGACGATA-3′ |
| Antisense: 5′-GGGGTGTTGAAGGTCTCAAA-3′ |
PCR: polymerase chain reaction; NLRP: Nod-like receptor protein; IL-1β: interleukin-1β.
8
Quantifying Mitochondrial DNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative copy number of mtDNA in terms of genomic DNA from blood samples was determined by calculating the ratio of the human mitochondrial 12S ribosomal RNA (12 s rRNA) gene to the haemoglobin subunit beta gene (β-globin) using SYBR Green PCR as previously described7 (link),19 (link). The standard curves for 12 s rRNA and β-globin genes were constructed by PCR amplification production using SYBR Green dye (Toyobo, Shanghai, China). The copy number of the target genes was calculated using the following formula: log10(CN) = −log10 (1 + Eff) × CT + log10 (CNT) (CN: copy number; Eff: amplification efficiency; CNT: copy number detection threshold).The relative copy number of mtDNA in terms of genomic DNA was calculated by analyzing the copy number ratio of 12 s rRNA to β-globin. PCR primers and amplification conditions for 12 s rRNA and β-globin genes are listed in Supplemental Table 1 .
9
Quantification of miRNA-203a-3p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cell RNA was extracted from fresh specimens and cells with TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) in accordance with the manufacturer's instructions. RT was performed with SYBR Premix Ex Taq according to manufacturer's protocols (Takara Bio, Inc.). RNU6B and GAPDH were used as endogenous controls. miRNA-203a-3p was reverse-transcribed using the following stem-loop RT primer: 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTTGAA-3′. qPCR was performed using FastStart Essential DNA Green Master (Roche Diagnostics) with miRNA-specific primers (forward, 5′-GUGAAAUGUUUAGGACCACUAG3′ and reverse, 5′-AGUGGUCCUAAACAUUUCACUU-3′; U6, forward, 5′-ATTGGAACGATACAGAGAAGATT-3′ and reverse, 5′-GGAACGCTTCACGAATTTG-3′). GAPDH, forward, 5′-ATCGTCCACCGCAAATGCTTCTA-3′ and reverse, 5′-AGCCATGCCAATCTCATCTTGTT-3′. THBS2, forward, 5′-CGTGGACAATGACCTTGTTG-3′ and reverse, 5′-GCCATCGTTGTCATCATCAG-3′. The reaction ran on the ABI 7900HT Sequence Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.) in the presence of SYBR-Green dye (Toyobo Life Science). qPCR was conducted as follows: 95°C for 10 min, 40 cycles at 95°C for 10 sec, 60°C for 30 sec and 72°C for 10 sec. Relative expression levels were calculated using the 2−ΔΔCq method.
10
Quantitative Gene Expression Analysis of TLR4
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription was performed in a 20-µl reaction system with a total of 2 µg of RNA M-MLV reverse transcriptase (Toyobo, Osaka, Japan). Quantitative RT-PCR and RT-PCR were performed with an ABI PCR Thermal Cycler Dice detection system and SYBR-Green dye (Toyobo) according to the manufacturer's instructions. The primers used were: human TLR4 forward, TGGGCAACCTGCTCTACCTA and reverse, GCTGTAGCTCGTTGGCAGA; and GAPDH forward, ACAACTTTGGTATCGTGGAAGG and reverse, GCCATCACGCCACAGTTTC.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!