Puretaq ready to go pcr bead

DNA extraction of tissues collected in absolute ethanol was performed using the commercial Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) following the manufacturer’s instructions after an initial rehydration step [67 (link)]. Positive and negative controls were used in each reaction, from DNA extraction to electrophoresis.
Multiplex polymerase chain reaction (PCR) was performed using the commercial PCR pureTaq Beads kit (illustrates PuReTaq Ready To Go PCR Beads^®, GE Healthcare, Chicago, IL, USA), and primers targeting the conserved region of Leishmania sp. kDNA minicircle: 150F (5′-GGG (G/T)AGGGGCGTTCT(C/G)CGAA-3′) and 152R (5′-(C/G)(C/G)(C/G)(A/T)CTAT (A/T)TTACACCAAC CCC-3′); and a conserved region of the mammalian GAPDH gene: 212F (5′-ACC ACAGTCCATGCCATCAC-3′) and 212R (5′-GTCAGGTCCACCACTGACAC-3′) [68 (link)]. The reactions were carried out as follows: 95 °C for 1 min, 30 cycles of 95 °C for 30 s, 61 °C for 30 s, and 72 °C for 30 s, followed by a final extension of 72 °C for 1 min. In addition, the PCR products were subjected to electrophoresis in 8% polyacrylamide mini gels revealed by silver nitrate using the PlusOne DNA Silver Staining^® kit (GE Healthcare, Chicago, IL, USA). The images of the gels were documented with a GS-800^® densitometer (Bio-Rad, Hercules, CA, USA).

To determine the plasmid region involved in the integration of pOrf4 into the chromosome, primers orf4-F/lcn2, ery5/orf4-R, eryrepF-F/repE-R, and repE-F/repE2-R listed in Table 2 were designed and combined in PCR reactions performed with PuRe Taq Ready-to-Go PCR beads (GE Healthcare, Buckinghamshire, United Kingdom), using as template the plasmid pOrf4, total DNA of L. lactis 200 g, and total DNA of L. lactis 400 g. Direct sequencing of the chromosome was carried out by Secugen (Madrid, Spain) using 2.5 - 3 μg of total DNA of L. lactis 200 g and of L. lactis 400 g and the primers 201 g-F/201 g-R and 402 g-F/402 g-R, respectively.

Total RNA was isolated from wild type (WT) Panc02 using trizol, and cDNA was synthesized using iScript kit (Biorad, Hercules, CA). Endpoint PCR was performed using the iScript cDNA and puReTaq Ready-To-Go PCR beads (GE Healthcare, Piscataway, NJ) in a Geneamp PCR System 9700. The PCR primers were designed using Integrated DNA Technologies web site. Primers for murine mesothelin were: ACCGACGAGGAACTGAATGCTCTT, and ACGATGGACTCATCCAACACTGCT. Primers to detect GAPDH expression were: AACTTTGGCATTGTGGAAGGGCTC and ACCCTGTTGCTGTAGCCGTATTCA. GAPDH control yielded a product size of 449 and the mesothelin amplicon was 473 bp. The PCR products were run on a 1 % agarose gel and the bands visualized with a Bio Doc-IT camera system (Fig. 2a).

RNA was extracted from 100 mg of transiently transformed fresh N. benthamiana leaves with the RNeasy mini kit (QIAGEN) following the manufacturer instructions. The extraction was performed on three plants for each vector transformation. Synthesis of cDNA was performed from 500 ng of RNA using the QuantiTect Reverse Transcription Kit from QIAGEN following the manufacturer instructions. PCR was then carried out with illustra^TM puReTaq Ready-To-Go PCR Beads from GE Healthcare, using 2 µL of cDNA previously synthesised, the specific primers at 7.5 pmol and water in 25 µL total volume. A standard three-step endpoint PCR cycling protocol was used, consisting of an initial denaturation at 95 °C then 25 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s and elongation at 72 °C for 75 s, with a final extension at 72 °C for 5 min.

To confirm the presence of P. brassicacearum MA250, we performed MA250 strain-specific SCAR-marker-detecting PCR. Colonies (115 pcs.) were picked from serial dilutions and plating viable count plates before and after IMC experiments for coated and surface-sterilized wheat seeds. Colonies were selected based on their morphology to cover putative MA250 and non-MA250 colonies. Selected colonies represented each independent experiment and seed treatment. Pure cultured MA250 colonies acted as positive controls for SCAR-PCR primers, and E. coli DH5α acted as negative controls. P. brassicacearum MA250-specific SCAR-PCRs were performed utilizing OPA2–648-forward (TGC CGA GCT GCT AAC CAG ATG CTG G) and OPA2–648-reverse (TGC CGA GCT GAG GGT CGA AGG TCG C) primers [33 (link)]. PCRs were run in illustra™ PuReTaq™ Ready-To-Go™ PCR beads (GE Healthcare, UK) supplemented with 1.25 μl of each primer (10 pmol/μl) and 22.5 μl of sterile ddH₂O. PCRs were run with the following program: 95 °C 2 min, 30x (95 °C 30 s, 65 °C 30 s, and 72 °C 30 s), and 72 °C 5 min. PCR products were analysed by agarose gel electrophoresis.

The presence of the regulatory gene wzg of the cps operon was examined in 66 S. mitis strains by PCR using two sets of primers: wzg-1-for (AATGCRRCITCIAAYTAYTCARTATTC) combined with wzg-1-rev (CCRTARGTRTCAATICCRCTIAYATA) and wzg-2-for (AGTGTIAYRGSICCRACWGRIACIRATAAKGA) combined with wzg-2-rev (TCIATCAWYTTCAARAAIGARGTRAARTTCAAICG), where “I” stands for deoxyinosine. The amplicons of 401 and 575 bp, respectively, generated by the wzg-1 and wzg-2 primer sets were detected by agarose gel electrophoresis. For the PCR, we used PuReTaq Ready-to-Go PCR beads (GE Healthcare, United Kingdom) in a 25-μl reaction mixture containing 1 ng genomic DNA and 50 pmol of each primer. A thermocycling program of 96°C for 1 min, 30 cycles of 96°C for 30 s, 55°C for 30 s, and 72°C for 1 min followed by an extension at 72°C for 5 min was used.