The largest database of trusted experimental protocols

6 protocols using fast sybr green master mix

1

Lung RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was purified from lung homogenates using Tri-Reagent (Sigma-Aldrich, Saint-Louis, MO) extraction protocol. RNA reverse transcription into cDNA was carried out with GoTaq qPCR-Master Mix (Promega, Madison, WI). RT-qPCR was performed with Fast SYBR Green Master mix (Promega) on an ARIA MX (Agilent Technologies, Santa Clara, CA). Primers for Fn1 (#QT00135758), Col3a (#QT01055516) and Timp1 (#QT00996282) were purchased from Qiagen (Qiagen, Hilden, Germany). RNA expression was normalized to Gapdh (#QT01658692, Qiagen, Hilden, Germany) expression and analyzed using the ΔΔCt method.
+ Open protocol
+ Expand
2

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tumor samples were immediately snap‐frozen in liquid nitrogen after harvesting. Total RNA was extracted using TRIzol reagent (#T9424, Sigma‐Aldrich, St. Louis, MO, USA). Complementary DNA was synthesized from 2 μg total RNA with the ImProm‐II Reverse Transcription System (#A3800, Promega, Madison, WI, USA), according to the manufacturer's directions. Real‐time PCR analysis was carried out with diluted cDNA, and Fast SYBR Green Master Mix (#4385616, Promega) was used. The sequences of the primers were as follows.
CD8A: forward, 5′‐TCCTCCTATACCTCTCCCAAAAC‐3′ – reverse, 5′‐GGAAGACCGGCACGAAGTG‐3′; IFNG: forward, 5′‐TCGGTAACTGACTTGAATGTCCA ‐3′ – reverse, 5′‐TCGCTTCCCTGTTTTAGCTGC‐3′; IDO1: forward, 5′‐TCTCATTTCGTGATGGAGACTGC‐3′ reverse, 5′‐GTGTCCCGTTCTTGCATTTGC‐3′; GAPDH forward: 5′‐GGAGCGAGATCCCTCCAAAAT‐3′ reverse, 5′‐GGCTGTTGTCATACTTCTCATGG‐3′.
Expression relative to the reference gene GAPDH was calculated as 2ΔCt , where ΔCt is Ctgene‐Ctctrl. If undetectable, Ct was given a value of 40.
+ Open protocol
+ Expand
3

RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was purified from lung homogenates by using Tri-Reagent (Sigma-Aldrich) extraction protocol. Reverse transcription of RNA into cDNA was carried out with GoScript™ Reverse Transcription System (Promega). RT-qPCR was performed with Fast SYBR Green Master mix (Promega) on anARIAMX(Agilent Technologies). Primers for Tnfsf13 (#QT00254023) were purchased from Qiagen (Qiagen, Hilden, Germany). RNA expression was normalized to Gapdh (#QT00166768) expression and analyzed using the ΔΔCt method.
+ Open protocol
+ Expand
4

qRT-PCR of STING, cGAS, and Fibronectin

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was purified from lung homogenates using Tri-Reagent (Sigma-Aldrich, Saint-Louis, MO) extraction protocol. RNA reverse transcription into cDNA was carried out with GoTaq qPCR-Master Mix (Promega, Madison, WI). RT-qPCR was performed with Fast SYBR Green Master mix (Promega) on an ARIA MX (Agilent Technologies, Santa Clara, CA). Primers Tmem173 (#QT00261590) encoding for STING, Mb21d1 (#QT00131929) encoding for cGAS, and Fn1 (#QT00135758) encoding for fibronectin were purchased from Qiagen (Qiagen, Hilden, Germany). RNA expression was normalized to Gapdh (#QT00166768, Qiagen, Hilden, Germany) expression and analyzed using the ΔΔCt method.
+ Open protocol
+ Expand
5

Lung RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was purified from lung homogenates by using Tri-Reagent (Sigma-Aldrich, Saint-Louis, MO) extraction protocol. Reverse transcription of RNA into cDNA was carried out with GoTaq qPCR-Master Mix (Promega, Madison, WI). RT-qPCR was performed with Fast SYBR Green Master mix (Promega) on an ARIA MX (Agilent Technologies, Santa Clara, CA). Primers for Tmem173 (#QT00261590), Mb21d1 (#QT00131929) and Ifnα4 (#QT01774353) were purchased from Qiagen (Qiagen, Hilden, Germany). RNA expression was normalized to Gapdh (#QT00166768) expression and analysed using the ΔΔCt method.
+ Open protocol
+ Expand
6

Total RNA Extraction and Real-Time qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted with Trizol (Invitrogen). cDNA was synthesized with M-MLV reverse transcriptase (Promega) and quantified by realtime qPCR using Biosystems StepOne™ Real-Time PCR system and Fast SYBR Green Master Mix (Promega). PCR primers were designed with NCBI online software Primer-BLAST and synthesized by Invitrogen. The sequences of primers used in this study are listed in Table 1.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!