RNA was extracted from cell pellets using RNAeasy Mini Kit (Qiagen). Contaminating genomic DNA was eliminated by treating the samples with RNase-free DNase (Qiagen). cDNA was synthesized from 1 µg RNA using Oligo(dT) primers and the Omniscript RT Kit (Qiagen), according to manufacturer instructions. Primer pairs (Sigma) were designed and used for detection of the different pluripotency factors, and to discriminate between the endogenous (OCT4A, SOX2, NANOG, and c-MYC) and the exogenous (LIN28-NANOG fusion) transcripts (Supplementary Table 1 ). As positive and negative controls rhesus embryonic stem cells (Rh_ESC) and MEFs, respectively, were used. Endogenous beta-actin (ACTNB) expression was used as a house-keeping gene. Taq DNA Polymerase with Standard Taq Buffer (New England BioLabs) was used for all RT-PCRs performed. Original gel electrophoresis pictures of RT-PCR analysis can be found in Supplementary Fig. 13 .
Taq dna polymerase with standard taq buffer
Manufactured by New England Biolabs
Sourced in United States
Taq DNA Polymerase with Standard Taq Buffer is a thermostable DNA polymerase enzyme used for DNA amplification in polymerase chain reaction (PCR) techniques. It catalyzes the synthesis of new DNA strands complementary to a template DNA sequence.
Automatically generated - may contain errors
Lab products found in correlation
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Itaq sybr green, by Bio-Rad (2 mentions)
Cfx96 real time system, by Bio-Rad (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Primer pair, by Merck Group (1 mentions)
Rnaeasy mini kit, by Qiagen (1 mentions)
Omniscript rt kit, by Qiagen (1 mentions)
Rnase free dnase, by Qiagen (1 mentions)
Race system, by Thermo Fisher Scientific (1 mentions)
3730 dna analyzer, by Thermo Fisher Scientific (1 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (1 mentions)
Fluorescein diacetate, by Merck Group (1 mentions)
Fluorescein, by Merck Group (1 mentions)
Deoxynucleotide dntp solution mix, by New England Biolabs (1 mentions)
Lc ms grade methanol, by Merck Group (1 mentions)
Formic acid, by Merck Group (1 mentions)
Acetonitrile, by Merck Group (1 mentions)
Protoscript first strand cdna synthesis kit, by New England Biolabs (1 mentions)
7 protocols using taq dna polymerase with standard taq buffer
1
Molecular Analysis of Pluripotency Factors
2
5' RACE for Scaffold Completion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to complete the inchoate 5′ ends of the five almost full-length scaffolds, a rapid amplification of cDNA ends (RACE) was performed. This 5′ RACE was carried out with a RACE-System (Invitrogen™, Carlsbad, CA, USA) according to the manufacturer’s instructions except of the usage of SuperScript™ III Reverse Transcriptase (Invitrogen™, Carlsbad, CA, USA) instead of SuperScript™ II Reverse Transcriptase (Invitrogen™, Carlsbad, CA, USA). Nested PCR was performed with gene specific primers (Table S1 ) and Taq DNA Polymerase with Standard Taq Buffer (New England BioLabs, Inc., Ipswich, MA, USA) as described by the manufacturer and an annealing temperature of 55 °C.
After visualization on a 1% agarose gel, PCR-products were excised of the gel and purified using NucleoSpin Gel and PCR Clean-up system (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol.
Each 3 μL of the purified PCR products was Sanger-sequenced using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) in a 3730 DNA Analyzer (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s protocol. Sequence data were analyzed using the Geneious software package (Biomatters, Auckland, New Zealand, Version 10.2.6), trimmed with an error probability limit of 0.05 on both ends and aligned to the respective scaffolds.
After visualization on a 1% agarose gel, PCR-products were excised of the gel and purified using NucleoSpin Gel and PCR Clean-up system (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol.
Each 3 μL of the purified PCR products was Sanger-sequenced using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) in a 3730 DNA Analyzer (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s protocol. Sequence data were analyzed using the Geneious software package (Biomatters, Auckland, New Zealand, Version 10.2.6), trimmed with an error probability limit of 0.05 on both ends and aligned to the respective scaffolds.
3
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA isolation was performed using ‘TRIzol’ (Invitrogen, USA) according to the company instructions. The RT-PCR was performed with ‘Superscript II Reverse Transcriptase’ (Invitrogen), according to company instructions. The PCR was performed with ‘Taq DNA Polymerase with Standard Taq Buffer’ (NEB) according to company’s instructions. qPCR was performed on CFX96 real-time system (Bio-Rad) using the SYBRGreen iTAQ according to manufacturer’s instructions. Primers based on human USH1C sequences (http://www.ncbi.nlm.nih.gov/gene/10083 ) are listed in Supplementary Material, Table S3 .
4
Quantification of Dabigatran Metabolites
5
Transcriptome Analysis of Mimulus Species
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from 100 mg of floral meristem, root, and leaves using TRIzol (Invitrogen) according to the manufacturer’s protocol. The RNA was further treated with DNaseI (RNase-free, New England Biolabs) followed by column purification using Monarch Total RNA Miniprep Kit (New England Biolabs). The ProtoScript First Strand cDNA Synthesis Kit (New England Biolabs) was used for the synthesis of cDNA using the manufacturer’s protocol. One μg of RNA was reverse transcribed using random primers.
RT-PCR was performed on the root, leaves, and floral meristem of M. cardinalis, M. guttatus, M. aurantiacus ssp. puniceus, M.parishii, M. verbenaceus, and M. lewisii. Four μl of 10X diluted cDNA was used in a 20 μl reaction mix. Taq DNA Polymerase with Standard Taq Buffer (New England Biolabs) was used for the amplification of TR under conditions as follows: 10 min at 95°C; 30 sec at 95°C; 30 cycles of 30 sec at 95°C, 30 sec at 55°C, 15 sec at 68°C; and final extension at 68°C for 5 min. The primers used for the RT-PCR are listed in theSupplementary Table 4 . The PCR products were electrophoresed at 95 volts for 40 minutes on a 2 % agarose gel stained with ethidium bromide.
RT-PCR was performed on the root, leaves, and floral meristem of M. cardinalis, M. guttatus, M. aurantiacus ssp. puniceus, M.parishii, M. verbenaceus, and M. lewisii. Four μl of 10X diluted cDNA was used in a 20 μl reaction mix. Taq DNA Polymerase with Standard Taq Buffer (New England Biolabs) was used for the amplification of TR under conditions as follows: 10 min at 95°C; 30 sec at 95°C; 30 cycles of 30 sec at 95°C, 30 sec at 55°C, 15 sec at 68°C; and final extension at 68°C for 5 min. The primers used for the RT-PCR are listed in the
6
Transcriptional Analysis of NLRP3 in Alveolar Macrophages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Porcine alveolar macrophages, 3D4/21 and endothelial cells were treated with ApxI for 1 h. Then the supernatant was removed and cells were lysed with TRIzol reagent (Ambion, #15596026). Direct‐zol RNA Miniprep (Zymo Research, #R2050) was used to purify total RNA following the manufacturer's instructions; the step of DNaseI treatment was included. For cDNA synthesis using the oligo (dT)18 primer, we used the RevertAid First Strand cDNA synthesis kit (Thermo Scientific, #k1622). Finally, PCR was carried out using Taq DNA Polymerase with Standard Taq Buffer (New England Biolabs, #M0273). The following primers were used: (Housekeeping) GAPDH sense: 5′‐GGCTGCCCAGAACATCATCC‐3′, antisense: 5′‐GACGCCTGCTTCACCACCTTCTTG‐3′ and NLRP3 sense: 5′‐GTGGTAACAGCCTGGGAGAC‐3′, antisense: 5′‐GTGCAACAGTCCCTCACAGA‐3′. After the agar gel electrophoresis, the GAPDH transcript resulted in a band with a molecular size of around 195 bp while the NLRP3 transcript was around 569 bp as expected.
7
RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LSVs. The RNA isolation was performed using "TRIzol" (Invitrogen, USA) according to company instructions. The reverse transcription (RT-PCR) was performed with "Superscript II Reverse Transcriptase" (Invitrogen), according to company instructions. The polymerase chain reaction (PCR) was performed with "Taq DNA Polymerase with Standard Taq Buffer" (NEB)
according to company´s instructions. qPCR was performed on CFX96 real-time system (Bio-Rad) using the SYBRGreen iTAQ according to manufacturer´s instructions. Primers based on human USH1C sequences (http://www.ncbi.nlm.nih.gov/gene/10083) are listed in Supplemental Table S3.
according to company´s instructions. qPCR was performed on CFX96 real-time system (Bio-Rad) using the SYBRGreen iTAQ according to manufacturer´s instructions. Primers based on human USH1C sequences (http://www.ncbi.nlm.nih.gov/gene/10083) are listed in Supplemental Table S3.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!