Log In Sign up
The largest database of trusted experimental protocols

Dneasy blood and tissue isolation kit

Manufactured by Qiagen
Visit Supplier
Sourced in Germany

The DNeasy Blood and Tissue Kit is a DNA isolation kit designed to extract high-quality genomic DNA from a variety of sample types, including blood, cultured cells, and solid tissues. The kit utilizes a silica-based membrane technology to capture and purify DNA, which can then be eluted for downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Cdna synthesis kit, by Thermo Fisher Scientific (2 mentions) Purelink rna isolation kit, by Thermo Fisher Scientific (2 mentions) Agilent bioanalyzer nano drop spectrometer, by Agilent Technologies (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Nanodrop onec microvolume uv vis spectrophotometer, by Thermo Fisher Scientific (1 mentions) Sybr green master mix, by Bio-Rad (1 mentions) Nucleospin gel and pcr clean up columns, by Takara Bio (1 mentions) Primestar max dna polymerase premix, by Takara Bio (1 mentions) Onestep pcr inhibitor removal kit, by Zymo Research (1 mentions) Coralload concentrate, by Qiagen (1 mentions) Hotstartaq plus master mix, by Qiagen (1 mentions) Hotstartaq plus master mix kit, by Qiagen (1 mentions)

8 protocols using dneasy blood and tissue isolation kit

1

Quantifying DNA Content in Embryonic Lungs

Check if the same lab product or an alternative is used in the 5 most similar protocols
For total DNA content measurements, DNA was isolated from whole lungs of Clp1K/K and littermate control E18.5 embryos using DNeasy blood and tissue isolation kit (Qiagen). DNA concentration of the samples was determined by NanoDrop OneC Microvolume UV–Vis Spectrophotometer (Thermo Scientific).
Szoták-Ajtay K., Szõke D., Kovács G., Andréka J., Brenner G.B., Giricz Z., Penninger J., Kahn M.L, & Jakus Z. (2020). Reduced Prenatal Pulmonary Lymphatic Function Is Observed in Clp1K/K Embryos With Impaired Motor Functions Including Fetal Breathing Movements in Preparation of the Developing Lung for Inflation at Birth. Frontiers in Bioengineering and Biotechnology, 8, 136.
+ Open protocol
+ Expand
2

Cytosolic mtDNA Extraction and Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cytosolic mtDNA was extracted as described previously (Bronner and O'Riordan, 2016 (link)). Briefly, cells contained in one 100 mm dish were scraped with 300 µl of 1% NP-40 and centrifuged at 15,000 g at 4°C for 15 min. Cytosolic DNA was isolated using a DNeasy Blood and Tissue Isolation kit (#69504, Qiagen, Germany) and quantified by optical density using NanoDrop One. At least 50 ng DNA was used for each PCR reaction. Human 18S was used to normalize the results.
Cotticelli M.G., Xia S., Truitt R., Doliba N.M., Rozo A.V., Tobias J.W., Lee T., Chen J., Napierala J.S., Napierala M., Yang W, & Wilson R.B. (2022). Acute frataxin knockdown in induced pluripotent stem cell-derived cardiomyocytes activates a type I interferon response. Disease Models & Mechanisms, 16(5), dmm049497.
+ Open protocol
+ Expand
3

RNA and DNA Isolation for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was prepared using the pure link RNA Isolation Kit (Invitrogen) or Trizol (Invitrogen). DNA was isolated using the DNeasy Blood and tissue isolation kit according to manufacturer’s protocol (Qiagen). The quality and concentration of RNA and DNA was determined by Agilent Bioanalyzer/Nano Drop Spectrometer. Isolated and purified total RNA was reverse transcribed by cDNA synthesis kit (Invitrogen). Taqman and CT kit was used for real time expression from the sorted cells. Real time PCR primers, DNMT1 (Mm01151063_m1), and HPRT (Mm01545399_m1), were designed either from applied biosystem site or Harward primer bank site (β-casein, ID1, ID2 and 18s).
Pathania R., Ramachandran S., Elangovan S., Padia R., Yang P., Cinghu S., Veeranan-Karmegam R., Arjunan P., Gnana-Prakasam J.P., Fulzele S., Pei L., Chang C.S., Choi H., Shi H., Manicassamy S., Prasad P.D., Sharma S., Ganapathy V., Jothi R, & Thangaraju M. (2015). DNMT1 is essential for mammary and cancer stem cell maintenance and tumorigenesis. Nature communications, 6, 6910.
+ Open protocol
+ Expand
4

Quantification of Mitochondrial DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
CD8+ T cells were isolated from WT and Hvcn1-deficient mice and activated for 4 days as described above. Total DNA was isolated using DNeasy blood and tissue isolation kit (Qiagen, catalog 69504) and eluted in 100 μL of EA buffer. DNA concentration was quantified using NanoDrop and diluted to a final concentration of 10 ng/μL in ddH2O. Mitochondria quantification was performed as previously described (33 (link)). Briefly, each quantitative PCR (qPCR) reaction was performed using 20 ng of DNA (2 μL) with 5 μL Sybr Green Master Mix (Bio-Rad), 0.5 μL each of forward and reverse primers, and 2 μL of ddH2O. The PCR reaction was performed using a Bio-Rad CFX96 thermocycler, at 95°C for 5 minutes followed by 45 cycles at 95°C for 10 seconds, 60°C for 10 seconds, and 72°C for 20 seconds. The mitochondrial copy number was calculated using the equation below:
ΔCt = Ct(nDNA gene) − Ct(mtDNA gene)
Copies of mtDNA = 2 × 2ΔCt
Coe D., Poobalasingam T., Fu H., Bonacina F., Wang G., Morales V., Moregola A., Mitro N., Cheung K.C., Ward E.J., Nadkarni S., Aksentijevic D., Bianchi K., Norata G.D., Capasso M, & Marelli-Berg F.M. (2022). Loss of voltage-gated hydrogen channel 1 expression reveals heterogeneous metabolic adaptation to intracellular acidification by T cells. JCI Insight, 7(10), e147814.
+ Open protocol
+ Expand
5

Genotyping AMS Mice via PCR and Restriction Enzyme Digestion

Check if the same lab product or an alternative is used in the 5 most similar protocols
The genotyping of AMS mice was performed as described previously [11 (link)]. In brief, DNA was isolated from the tail, the spleen, or cultured cells using DNeasy blood and tissue isolation kit (Qiagen, Hilden, Germany) following the manufacturer’s instruction. Then, a DNA fragment of the Nna1 gene was PCR amplified, and the genotype was determined by restriction enzyme digestion using BstB1 (New England BioLab, Ipswich, MA, USA) that digested non-mutated DNA.
Sheikh A.M., Yano S., Tabassum S., Omura K., Araki A., Mitaki S., Ito Y., Huang S, & Nagai A. (2021). Alteration of Neural Stem Cell Functions in Ataxia and Male Sterility Mice: A Possible Role of β-Tubulin Glutamylation in Neurodegeneration. Cells, 10(1), 155.
+ Open protocol
+ Expand
6

RNA and DNA Isolation for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was prepared using the pure link RNA Isolation Kit (Invitrogen) or Trizol (Invitrogen). DNA was isolated using the DNeasy Blood and tissue isolation kit according to manufacturer’s protocol (Qiagen). The quality and concentration of RNA and DNA was determined by Agilent Bioanalyzer/Nano Drop Spectrometer. Isolated and purified total RNA was reverse transcribed by cDNA synthesis kit (Invitrogen). Taqman and CT kit was used for real time expression from the sorted cells. Real time PCR primers, DNMT1 (Mm01151063_m1), and HPRT (Mm01545399_m1), were designed either from applied biosystem site or Harward primer bank site (β-casein, ID1, ID2 and 18s).
Pathania R., Ramachandran S., Elangovan S., Padia R., Yang P., Cinghu S., Veeranan-Karmegam R., Arjunan P., Gnana-Prakasam J.P., Fulzele S., Pei L., Chang C.S., Choi H., Shi H., Manicassamy S., Prasad P.D., Sharma S., Ganapathy V., Jothi R, & Thangaraju M. (2015). DNMT1 is essential for mammary and cancer stem cell maintenance and tumorigenesis. Nature communications, 6, 6910.
+ Open protocol
+ Expand
7

CRISPR Guide Cassette Isolation and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was isolated using the DNeasy Blood and Tissue Isolation Kit (QIAGEN). For melanocyte samples, the gDNA was cleaned of melanin using the OneStep™ PCR Inhibitor Removal Kit (Zymo). To isolate the CRISPR guide cassette from the genome, PCR was done at one reaction for every 5×105 cells using PrimeSTAR Max DNA Polymerase Premix (Takara). At this time, a unique 9-mer barcode was added to each guide cassette amplicon for removal of PCR duplicates (Table S7). Subsequent to 5 cycles of PCR, the reactions were pooled over NucleoSpin Gel and PCR Clean-Up Columns (Takara). A second PCR of 23-25 cycles was done to prepare the DNA for flow cell binding, including barcoding for multiplexing, and sufficient amplification. Standard Illumina i5/i7 barcodes were used. This round of PCR was followed by PCR cleanup over a single column and run on a 2.5% agarose gel to isolate the single product band for high-throughput sequencing. When necessitated by Bioanalyzer trace results, a secondary PAGE purification was carried out via standard protocol and purified over PCR cleanup columns. Samples were sequenced to a minimum average per unique guide coverage of 100× on the NextSeq Platform.
Kovalski J.R., Bhaduri A., Zehnder A.M., Neela P.H., Che Y., Wozniak G.G, & Khavari P.A. (2019). The Functional Proximal Proteome of Oncogenic Ras Includes mTORC2. Molecular cell, 73(4), 830-844.e12.
+ Open protocol
+ Expand
8

Cytochrome b Gene Amplification from Fin Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total genomic DNA was isolated from fin tissue samples using the DNeasy Blood and Tissue isolation Kit (Qiagen), following the manufacturer's instructions. Polymerase chain reactions (PCR) were prepared using Hot Star Taq Plus Master Mix Kit (Qiagen) and a specific set of primers, Glu-F 5' GAAGAACCACCGTTGTTATTCAA 3' and Thr-R 5' ACCTCCRATCTYCGGATTACA 3' (Zardoya and Doadrio, 1998) , used to amplify the cytochrome b gene in its full length, 1141 base pairs (bp). The prepared PCR reactions contained 12.5 mL Hot Star Taq Plus Master Mix (Qiagen), 2.5 mL CoralLoad Concentrate (Qiagen), 2 mL RNase-Free Water, 2 mL of each primer and 4 mL isolated DNA, in total 25 mL. The PCR protocol was optimized as following: first denaturation step, 10 min at 95 °C; 35 cycles À denaturation for 45 s at 92 °C, annealing for 90 s at 48 °C, extension for 105 s at 72 °C and the final polymerisation step for 7 min at 72 °C. Sequencing was conducted by Macrogen Europe (Netherlands). For sequence alignment, BioEdit 7.2.5 software (Hall, 1999) was used, and all chromatograms were visually checked while aligning.
Raguž L., Buj I., Marčić Z., Veble V., Ivić L., Zanella D., Horvatić S., Mustafić P., Ćaleta M., & Sabolić M. (2021). First look into the evolutionary history, phylogeographic and population genetic structure of the Danube barbel in Croatia. Knowledge and Management of Aquatic Ecosystems.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!