Mouse anti myc antibody sc 40

The kAE1 proteins were examined by Western blot analysis, as previously described [22 (link)]. The wild-type and mutant kAE1 proteins were subjected to electrophoresis on 10% SDS-PAGE gel and transferred to nitrocellulose membranes. The membranes were incubated with mouse anti-Myc antibody (sc-40, Santa Cruz Biotechnology, Dallas, TX, USA) or mouse anti-GAPDH antibody (Santa Cruz Biotechnology) overnight at 4 °C. The membranes were then incubated with rabbit anti-mouse secondary antibody conjugated to horseradish peroxidase (Dako Cytomation, Glostrup, Denmark) for 1 h. The kAE1 proteins were detected by addition of SuperSignal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific) according to the manufacturer’s protocol. The chemiluminescence signals were visualized using a G:BOX Chemiluminescence Imaging System, and their intensities were quantified using GeneTools software version 4.03 (Syngene, Cambridge, UK).

Immunoprecipitation of expressed GTPBP8-myc was performed using Dynabeads™ Protein G (10004D, Invitrogen) according to the manufacturer's instructions. Briefly, 50 µL Dynabeads™ Protein G beads were first coated with 1 µg mouse anti-MYC antibody (sc-40, Santa Cruz Biotechnology) or normal mouse IgG1 (sc-3877, Santa Cruz Biotechnology). After transient expression of GTPBP8-myc in U2OS cells for 48 h, mitochondria were extracted and lysed in ice-cold 1% DDM in PBS buffer containing a complete protease inhibitor cocktail. After 60 min of incubation on ice, the insolubilized material was removed by centrifugation at 20,000 ×g for 20 min at 4 °C. The supernatants were subsequently incubated with antibody-bound Dynabeads™ Protein G overnight at 4 °C. After washing, the protein G Dynabeads-antibody-protein was eluted with 50 mM glycine (pH 2.8) to dissociate the complex at RT for 2 min. The samples were subjected to SDS-PAGE and immunoblotting.

The full-length sequence of human lnc-RPS6P3 was cloned into the pLentiLox3.7 plasmid. To generate pLL3.7-lnc-RPS6P3-S1, the S1 aptamer sequence containing a 44-nt (5′-ACCGACCAGAATCATGCAAGTGCGTAAGATAGTCGCGGGCCGGG-3′) was inserted into the 3′-end of lnc-RPS6P3. The short hairpin RNA (shRNA) targeting lnc-RPS6P3 was constructed into pSIH-H1-GFP lentiviral vector. The shRNA target sequences were as follows: shRNA-lnc-RPS6P3#1, GCGTATTGCTCTGAAGAAACA; shRNA-lnc-RPS6P3#2, GGCGTATTGCTCTGAAGAAAC.
Mouse anti-M1, anti-PB1, anti-PB2, anti-PA and rabbit anti-NP antibodies were kindly provided by Prof. Wenjun Liu. Mouse anti-β-actin (KM9001), anti-GAPDH (KM9002) antibodies were purchased from Sungene Biotech Co. (Tianjin, China). Mouse anti-Flag antibody (F3165) was purchased from Sigma (Kawasaki, Japan). Mouse anti-Myc antibody (sc-40) was purchased from Santa Cruz (Dallas, TX, USA). HRP-conjugated secondary antibodies (115-035-003 (anti-mouse IgG) or 111-035-003 (anti-rabbit IgG)) were purchased from The Jackson Laboratory (Bar Harbor, ME, USA). Rabbit anti-RIG-I antibody (3743S) was purchased from Cell Signaling Technology (Danvers, MA, USA).
The protein-coding potential of lnc-RPS6P3 was analyzed using the Coding Potential Calculator (CPC2.0) software (http://cpc2.gao-lab.org/index.php) accessed on 5 June 2022 [30 (link)].