Lentiviral system

Gene silencing was performed using specific shRNAs delivered by a lentiviral system acquired from Sigma‐Aldrich (Shanghai, China), following the instructions provided. Briefly, to yield lentiviruses containing specific shRNA sequences, 293T cells were cotransfected with 2.5 μg pMD2.G and 7.5 μg psPAX2 packaging plasmids and 10 μg of the pLKO.1 plasmid containing the specific shRNA for 24 hours. The lentivirus containing cultured medium was collected and stored at −80℃ as aliquots until further use. To deliver the specific shRNA construct, approximately 10% confluent cells were incubated with the lentivirus bearing specific shRNA in growth medium containing 8 mg/mL polybrene at 37℃ for 24 hours. The transduced cells were then selected with 2 mg/mL puromycin. For small interfering RNA assay, cells were cultured for 16 hours in 6‐well plates before transfection. The siRNA oligonucleotides were as follows:
si‐Aur‐A‐1:5′‐AUGCCCUGUCUUACUGUCA‐3′;
si‐Aur‐A‐2:5′‐GGCAACCAGTGTACCTCAT‐3′;
si‐Aur‐A‐3:5′‐ATTCTTCCCAGCGCGTTCC‐3′;
si‐FOXM1‐1:5′‐GCACTATCAACAATAGCCTAT‐3′;
si‐FOXM1‐2:5′‐GCCAATCGTTCTCTGACAGAA‐3′;
si‐FOXM1‐3:5′‐GGACCACUUUCCCUACUUU‐3′;
control: 5′‐UUCUCCGAACGUGUCACGU‐3′.
siRNA was transfected into cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. To confirm down‐regulation efficacy, targeted genes were detected by Western blot.

Knockdown of genes was performed with specific shRNAs delivered using a lentiviral system purchased from Sigma-Aldrich Corp. according to the instructions provided by the manufacturer. In brief, to generate the lentivirus containing the specific shRNA, 293T cells were cotransfected with 2.5 mg pMD2.G and 7.5 mg psPAX2 compatible packaging plasmids and 10 mg of pLKO.1 plasmid bearing the specific shRNA for 24 hours. Culture medium containing the generated lentiviruses was collected and stored at –80°C as aliquots for further use. To deliver the specific shRNA construct, approximately 10% confluent cells were infected with lentiviruses bearing the specific shRNA in growth medium containing 8 mg/ml Polybrene and were incubated at 37°C for 24 hours. Transfected cells were subsequently selected with 2 mg/ml puromycin at approximately 50% confluence. Details on the shRNAs are provided in Supplemental Table 7.

Gene silencing was performed using specific shRNAs delivered by a lentiviral system acquired from Sigma-Aldrich (Shanghai, China), following the instructions provided. Briefly, to yield lentiviruses containing specific shRNA sequences, 293T cells were co-transfected with 2.5 μg pMD2.G and 7.5 μg psPAX2 packaging plasmids and 10 μg of the pLKO.1 plasmid containing the specific shRNA for 24 h. The lentivirus containing cultured medium was collected and stored at −80°C as aliquots until further use. To deliver the specific shRNA construct, approximately 10% confluent cells were incubated with the lentivirus bearing specific shRNA in growth medium containing 8 mg/ml polybrene at 37° for 24 h. The transduced cells were then selected with 2 mg/ml puromycin. All shRNA constructs used are shown in Supplementary Table S2.