Kanamycin b

Manufactured by Merck Group

Sourced in United States

Kanamycin B is an antibiotic compound produced by the bacterium Streptomyces kanamyceticus. It is commonly used in molecular biology research and applications as a selective agent in the growth of genetically modified organisms.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Kanamycin (1115 citations)

7 protocols using kanamycin b

Antibiotics and Nucleoside Precursor Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

EXAMPLE 1

Preparation of Materials

Standard kanamycin, kanamycin B, neomycin, paromomycin, tobramycin, and amikacin were purchased from Sigma (USA). 2-mercaptoethanol, phenylmethyl-sulfonyl fluoride (PMSF), phenol/chloroform/isoamyl alcohol (25:24:1), uridine 5′-diphospho-D-glucose (UDP-Glc), and glass beads (150 to 212 μm) were also purchased from Sigma. Heptafluorobutyric acid (HFBA) was obtained from Fluka, and HPLC-grade acetonitrile, methanol, and water were obtained from J. T. Baker. 2-deoxystreptamine (2-DOS, compound 1) and UDP-2-N-acetyl-D-glucosamine (UDP-GlcNAc) were purchased from GeneChem (Republic of Korea). Cation solid-phase exchanger (OASIS MXC SPE, 3 mL/60 mg) and vacuum manifold were purchased from Waters. The culture medium components, soybean meal, yeast extract, and malt extract were acquired from BD Science (USA).

Paromamine and neamine were prepared from paromomycin and neomycin, respectively, by methanolysis. UDP-2-D-glucosamine (UDP-GlcN) was prepared by enzymatic reaction of UDP-D-glucose pyrophosphorylase with glucosamine-1-phosphate and uridine 5′-triphosphate (UTP). Escherichia coli DH10B and plasmid Litmus 28 (New England Biolabs) were used for routine subcloning. High-copy number E. coli-Streptomyces shuttle vector pSE34 containing the strong ermE* promoter plus a thiostrepton resistance marker was used as an expression plasmid.

US10337044B2. Kanamycin compound, kanamycin-producing Streptomyces species bacterium, and method of producing kanamycin (2019-07-02). iNtRON Biotechnology, Inc. [KR]. Inventors: Yeo Joon Yoon [KR], Sung Ryeol Park [KR], Je Won Park [KR], Jae Kyung Sohng [KR].

+ Open protocol

+ Expand

Binding Affinity of Aminoglycoside Antibiotics

Check if the same lab product or an alternative is used in the 5 most similar protocols

All RNA oligonucleotides used in this study were purchased from Integrated DNA Technologies Inc. (IDT, Coralville, IA, USA) and stored at −20 °C in ddH₂O (deionized-distilled water) until tested in the ITC or in 2AP fluorescence experiments. Sequences of the oligonucleotides used in this study are shown in Table S1. Neomycin-B, ribostamycin, paromomycin, tobramycin, kanamycin-A, kanamycin-B, sisomicin, geneticin, netilmicin, and amikacin were obtained as their sulfate salts from Sigma-Aldrich (St. Louis, MO, USA). Cacodylic acid was purchased from Amresco (Solon, OH) and sodium cacodylate was from Sigma-Aldrich (St. Louis, MO, USA). All other chemicals were reagent grade and obtained from Fisher Scientific (Pittsburgh, PA, USA). The constituents of the low ionic strength buffer (A) and high ionic strength buffer (F) are listed in Table S1.

Ilgu M., Yan S., Khounlo R.M., Lamm M.H, & Nilsen-Hamilton M. (2019). Common Secondary and Tertiary Structural Features of Aptamer–Ligand Interaction Shared by RNA Aptamers with Different Primary Sequences. Molecules, 24(24), 4535.

+ Open protocol

+ Expand

Kinetic Analysis of ANT(2''-Ia) Adenylylation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Adenylylation of aminoglycosides was monitored using the continuous EnzChek pyrophosphatase assay (Life Technologies). Reactions were carried out in 96-well plates, monitored at 360 nm, and consisted of 50 mM HEPES (pH 7.5), 40 mM KCl, 10 mM MgCl2, 5 μg of ANT(2′′)-Ia, and varying concentrations of aminoglycoside, in a final volume of 100 μL. Reactions were performed in triplicate and incubated at 25 °C for 10 min followed by initiation with ATP (300 μM final concentration); reactions were subsequently monitored for 10 min. Varying concentrations of kanamycin B (Sigma-Aldrich) were used to determine the K_m of ANT(2′′)-Ia. The enzyme was then examined for its ability to use plazomicin as a substrate. Assays were conducted utilizing the same conditions, substituting kanamycin B for plazomicin (250 μM). Plazomicin was then assessed for its ability to inhibit ANT(2′′)-Ia using the same assay, with kanamycin B at K_m and plazomicin at 300 μM

Cox G., Ejim L., Stogios P.J., Koteva K., Bordeleau E., Evdokimova E., Sieron A.O., Savchenko A., Serio A.W., Krause K.M, & Wright G.D. (2018). Plazomicin Retains Antibiotic Activity against Most Aminoglycoside Modifying Enzymes. ACS infectious diseases, 4(6), 980-987.

+ Open protocol

+ Expand

Effects of Tobramycin and Kanamycin on Melanogenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tobramycin and kanamycin A were purchased from Tokyo Chemical Industry Co., Ltd. (Chuo-ku, Tokyo, Japan). Dulbecco’s Modified Eagle Medium (DMEM), fetal bovine serum (FBS), penicillin/streptomycin, trypsin-ethylenediaminetetraacetic acid, PD98059, and BCA kit were procured from Thermo Fisher Scientific (Waltham, MA, USA). α-MSH, NaOH, MTT, and kanamycin B were obtained from Sigma-Aldrich (St. Louis, MO, USA). Antibodies against tyrosinase, TRP-1, TRP-2, and MITF were obtained from Santa Cruz Biotechnology (Dallas, TX, USA). Antibodies against p-p38, p38, p-JNK, JNK, p-ERK, ERK, p-AKT, AKT, and β-actin were purchased from Cell Signaling Technology (Danvers, MA, USA). Radioimmunoprecipitation assay (RIPA) buffer, dimethyl sulfoxide (DMSO), enhanced chemiluminescence (ECL) kit, and 2× Laemmli sample buffer were obtained from Biosesang (Sungnam, Gyeonggi-do, Korea). SP600125 and SB203580 were purchased from Cayman Chemical (Ann Arbor, MI, USA) and Calbiochem (San Diego, CA, USA); 2-DOS was obtained from Toronto Research Chemicals Inc. (Toronto, Ontario, Canada). EZ-LDH cell cytotoxicity assay kit was purchased from DoGenBio Co.,Ltd (Guro, Seoul, Korea).

Moon S.H., Chung Y.C, & Hyun C.G. (2019). Tobramycin Promotes Melanogenesis by Upregulating p38 MAPK Protein Phosphorylation in B16F10 Melanoma Cells. Antibiotics, 8(3), 140.

+ Open protocol

+ Expand

Overexpression of AhGLK1 in Arabidopsis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The cDNA encoding AhGLK1 was amplified from peanut and cloned into the modified pCanG plasmids (p35S:eGFP) to obtain p35S:AhGLK1-eGFP by a homologous recombination method. The primers used to construct this plasmid are as follows: F (5′–3′): GGGTTCGAAATCGATGGATCCATGCTTGCGGTGTCACCTTTG; R (5′–3′): GTCCTAGGCTACGTAGGATCCTTAATTAAGCACAGGAGTTGC. The floral dip method was used to transform the plasmids into the glk1glk2 Arabidopsis strain as previously reported^{51 (link)}. Dark-green F1 progeny were selected on 0.5× MS medium containing 50 mg/L kanamycin B (Sigma-Aldrich) and selfed. The F2 generation was screened for dark-green individuals representing AhGLK1/glk1glk2 homozygotes. These individuals were selfed, and F3 seeds were then sown on kanamycin B to identify lines homozygous for 35 S::AhGLK1/glk1glk2.

Liu X., Li L., Li M., Su L., Lian S., Zhang B., Li X., Ge K, & Li L. (2018). AhGLK1 affects chlorophyll biosynthesis and photosynthesis in peanut leaves during recovery from drought. Scientific Reports, 8, 2250.

+ Open protocol

+ Expand

Aminoglycoside-RNA Aptamer Binding Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Neomycin-B, paromomycin, ribostamycin, tobramycin, kanamycin-A, kanamycin-B, sisomicin, geneticin, netilmicin, and amikacin (Figs. 1A, 3B) were obtained as their sulfate salts from Sigma-Aldrich. All RNA oligonucleotides were from Integrated DNA Technologies Inc., and were maintained at −20°C in deionized distilled water (ddH₂O) until use. Sodium cacodylate was from Sigma-Aldrich and cacodylic acid was from Amresco. All other chemicals were from Fisher Scientific. Buffers were as follows: A (13.5 mM NaCl, 150 mM KCl, 20 mM HEPES, 0.22 mM Na₂HPO₄, 0.44 mM KH₂PO₄, 120 μM MgCl₂, 120 nM CaCl₂, 100 μM MgSO₄ at pH 7.3), N (10 mM Na₂HPO₄ at pH 7.3), and F (5 mM MgCl₂, 200 mM NH₄CI, 80 mM KCl, 80 mM Na-cacodylate at pH 7.4). All buffers were prepared with deionized distilled water and their pH's were measured at 25°C. Sequences of the RNA aptamers used in this study are shown in Supplemental Table S1. The buffer components used to determine the effect of [I] on aminoglycoside binding are listed in Supplemental Table S2.

Ilgu M., Fulton D.B., Yennamalli R.M., Lamm M.H., Sen T.Z, & Nilsen-Hamilton M. (2014). An adaptable pentaloop defines a robust neomycin-B RNA aptamer with conditional ligand-bound structures. RNA, 20(6), 815-824.

+ Open protocol

+ Expand

Antibacterial Activity Evaluation of TS2037

Check if the same lab product or an alternative is used in the 5 most similar protocols

TS2037, evaluated here, was synthesized at the Pharmaceutical Research Center, Meiji Seika Pharma Co., Ltd. (Meiji, Kanagawa, Japan) [12] . The following reference antibacterial agents were purchased commercially: arbekacin, amikacin, and kanamycin B (Meiji), tobramycin and gentamicin (Sigma Chemical Co., St. Louis, MO, USA), imipenem/cilastatin (MSD, Tokyo, Japan), vancomycin (Shionogi & Co. Ltd., Osaka, Japan), teicoplanin (Sanofi K. K., Tokyo, Japan), linezolid (Pfizer Japan Inc., Tokyo, Japan), ciprofloxacin (Sequoia Research Products Ltd., Oxford, United Kingdom), and cefepime (Bristol-Myers Squibb Company, Tokyo, Japan).

Hirai Y., Maebashi K., Fushimi H., Hiraiwa Y., Murakami S., Usui T., Akiyama Y., Minowa N, & Ikeda D. (2018). In vitro and in vivo antimicrobial activity of TS2037, a novel aminoglycoside antibiotic. The Journal of antibiotics, 71(3).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!