Potential gRNA sequences for zebrafish elovl2 were searched for using the Chop-chop algorithm (https://chopchop.cbu.uib.no ). Two elovl2 gRNA sequences were selected, GACAGCCTATTTGGAGAAAG in exon 2 and TTCCCAGGTAGATTGTTAGG in exon 3. The control gRNA used (TGAGTATTCGCATGCAACTA) does not target any known zebrafish nucleotide sequence.
GRNA oligonucleotides (Integrated DNA Technologies (IDT), Coraville Iowa) were synthesized by and were duplexed individually with tracrRNA (Integrated DNA Technologies (IDT) Coraville, IA, USA). The injection mix containing 250 ng/μL of gRNA duplex complex (both gRNAs), 500 ng/μL rCas9 protein (PNA Bio CP01-20 Thousand Oaks, CA, USA) and duplex buffer (IDT) was injected into one cell stage zebrafish embryos. The embryos were maintained in a 28 °C incubator. The level of DNA editing was determined through DNA Sanger sequencing (Genewiz La Jolla, CA, USA) and analysis using the ICE v2CRISPR Analysis Tool (Synthego (Redwood City, CA, USA), found athttps://www.synthego.com/products/bioinformatics/crispr-analysis ) [20 ] Sequencing primers for elovl2 gRNA exon 2 were 5′ TTGAAGCTTGCAATCTGACTGT3′ and 5′ TGGAACGTTCTATTGAGTGTCG 3′. Sequencing primers for elovl2 gRNA exon 3 were 5′ TTTGTTTGATGTCAGATACCCG3′ and 5′ ATGAGCACATGGACTGCTATTG3′.
GRNA oligonucleotides (Integrated DNA Technologies (IDT), Coraville Iowa) were synthesized by and were duplexed individually with tracrRNA (Integrated DNA Technologies (IDT) Coraville, IA, USA). The injection mix containing 250 ng/μL of gRNA duplex complex (both gRNAs), 500 ng/μL rCas9 protein (PNA Bio CP01-20 Thousand Oaks, CA, USA) and duplex buffer (IDT) was injected into one cell stage zebrafish embryos. The embryos were maintained in a 28 °C incubator. The level of DNA editing was determined through DNA Sanger sequencing (Genewiz La Jolla, CA, USA) and analysis using the ICE v2CRISPR Analysis Tool (Synthego (Redwood City, CA, USA), found at