Quick dna fungal bacterial miniprep kit

The genomic DNA of strain CNUC13 was extracted using the Quick-DNA Fungal/Bacterial Miniprep Kit (Zymo Research, Orange, CA, USA) in accordance with the kit instruction manual. The molecular identification of CNUC13 was conducted via polymerase chain reaction (PCR) amplification and sequencing of the 16S rRNA region using primers 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-TACGGYTACCTTGTTACGACTT-3′) [30 (link)]. The resulting sequences were used to search the NCBI GenBank database (https://www.ncbi.nlm.nih.gov/ 13 January 2022) via BLASTn. Multiple alignments were performed using the default settings in the MEGA software (version X) [31 (link)]. The neighbor-joining method was utilized in MEGA X, applying the best-fit model of molecular evolution with 1000 bootstrap replicates computed; bootstrap (BS) values above 80% were considered highly supported. Sequences obtained in the present study were submitted to the NCBI GenBank database.

Presumptive positive colonies (blue-black) from RAPID'L.mono plates (AEC Amersham) were sub-cultured on 2% blood agar (NHLS, Greenpoint) for overnight growth at 37 °C. All cells recovered from blood agar were subjected to DNA extraction using the Quick-DNA™ Fungal/Bacterial Miniprep Kit (ZymoResearch) according to the manufacturer's instructions. Strains were confirmed as L. monocytogenes by using polymerase chain reaction (PCR) to amplify a 730 bp region of the hlyA gene [45] ,[46] , which is innate to all L. monocytogenes bacteria and encodes for a pore-forming haemolysin [47] (link)–[50] . For added lineage characterisation, isolates were characterised as either lineage I, II or III by a SNP based PCR-RFLP method designed by an author of this study [51] (link). Briefly, the hlyA amplicons underwent restriction digestion with enzymes NdeI, HaeII and Bsh1285I to produce band sizes indicative of lineage I, II or III respectively [51] (link). All amplicons and restriction digests were visualised by gel electrophoresis on a 1.5% agarose gel (Lonza, WhiteHead Scientific), stained with SmartGlowTM pre-stain (Whitehead Scientific).

Genomic DNA was extracted from the above seven strains and DSM 21625, DSM 2542^T, and DSM 6285 using Quick-DNA Fungal/Bacterial Miniprep Kit (Zymo Research). Partial gyrA, recN and rpoB, gene fragments of each strain were amplified by PCR using OneTaq Hot Start Quick-Load 2X Master Mix, Standard Buffer (New England Biolabs) with the primer pairs; gyrAf (GCAAAGCGTATGAAACAGG) and gyrAr GTTCGACAAAGTCATCTTCG), recNf (ACGCTTGTCGATAT TCACG) and recNr (CGCTAAGACGGCTTTCAAT), and rpoBf (GTTTGCATCCGCTTGTATG) and rpoBr (TCTTAAA TGGCGGAACGAG). A phylogenetic tree was constructed based on the concatenated alignments of the above genes using IQ-TREE v1.6.7 with the optimal substitution model determined through model test and ultrafast support (UFBoot; n = 1,000 replicates) (Schmidt et al., 2014 (link)). The phylogeny was visualized using MEGA7 (Kumar et al., 2016 (link)). Genome-based taxonomic affiliation of the seven compared P. thermoglucosidasius genomes (Table 1) was verified using GTDB-Tk v1.7.0 (Chaumeil et al., 2019 (link); Parks et al., 2020 (link)). All basic sequence processing and computation of the identity matrix were performed using BioEdit (Hall, 1999 ).

For WGS and PCR-based amplification, isolates were grown shaking in SG broth at 37°C, and genomic DNA was isolated using the Quick-DNA fungal/bacterial miniprep kit (Zymo Research, Irvine, CA) according to the manufacturer’s suggested protocol.