Escherichia coli topoisomerase I was obtained from New England Biolabs (Ipswich, MA). Calf thymus topoisomerase I and pBR322 plasmid were provided by Takara Bio Inc. (Shiga, Japan). All the buffers and solutions are prepared by the biological purity water. All the ODNs were purchased from Sigma-Aldrich, which were used as topoisomerase inhibitors here. The sequence of single-stranded ODN (ssODN-1) with 50-mer is 5′ CAACAGCGGTAAGTAGAGCTGGTATTGCACAACATGGATCATGTAACTCG 3′. The double-stranded ODN was prepared by heating the single-stranded ODN (ssODN-1) and its complimentary strand (ssODN-2) in a solution containing 10 mM Tris-HCl (pH = 7.8), 50 mM NaCl, and 1 mM EDTA for 5 minutes at 95°C. The resulting mixture was slowly cooled to room temperature.
Escherichia coli topoisomerase 1
Manufactured by New England Biolabs
Escherichia coli topoisomerase I is an enzyme that catalyzes the relaxation of supercoiled DNA. It is responsible for relieving torsional stress in DNA during processes such as transcription and replication.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using escherichia coli topoisomerase 1
1
Topoisomerase-Mediated DNA Relaxation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
Escherichia coli topoisomerase I was obtained from New England Biolabs (Ipswich, MA). Calf thymus topoisomerase I and pBR322 plasmid were provided by Takara Bio Inc. (Shiga, Japan). All the buffers and solutions are prepared by the biological purity water. All the ODNs were purchased from Sigma-Aldrich, which were used as topoisomerase inhibitors here. The sequence of single-stranded ODN (ssODN-1) with 50-mer is 5′ CAACAGCGGTAAGTAGAGCTGGTATTGCACAACATGGATCATGTAACTCG 3′. The double-stranded ODN was prepared by heating the single-stranded ODN (ssODN-1) and its complimentary strand (ssODN-2) in a solution containing 10 mM Tris-HCl (pH = 7.8), 50 mM NaCl, and 1 mM EDTA for 5 minutes at 95°C. The resulting mixture was slowly cooled to room temperature.
+ Expand
Escherichia coli topoisomerase I was obtained from New England Biolabs (Ipswich, MA). Calf thymus topoisomerase I and pBR322 plasmid were provided by Takara Bio Inc. (Shiga, Japan). All the buffers and solutions are prepared by the biological purity water. All the ODNs were purchased from Sigma-Aldrich, which were used as topoisomerase inhibitors here. The sequence of single-stranded ODN (ssODN-1) with 50-mer is 5′ CAACAGCGGTAAGTAGAGCTGGTATTGCACAACATGGATCATGTAACTCG 3′. The double-stranded ODN was prepared by heating the single-stranded ODN (ssODN-1) and its complimentary strand (ssODN-2) in a solution containing 10 mM Tris-HCl (pH = 7.8), 50 mM NaCl, and 1 mM EDTA for 5 minutes at 95°C. The resulting mixture was slowly cooled to room temperature.
2
Radiolabeling of DNA Fragments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Agar, yeast extract and tryptone were obtained from Midwest Scientific. T4 polynucleotide kinase and Escherichia coli topoisomerase I were purchased from New England Biolabs. [γ-32P]ATP was from ICN Radiochemicals. All other biochemicals were from Sigma.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!