Dnase 1

Manufactured by Worthington

Sourced in United States, Switzerland, Germany, Japan, Canada

DNase I is an enzyme that catalyzes the degradation of DNA by hydrolyzing the phosphodiester bonds. It is commonly used in molecular biology and biotechnology applications for the removal of DNA from samples or reactions.

Automatically generated - may contain errors

Lab products found in correlation

Papain, by Worthington (46 mentions) Collagenase 4, by Worthington (35 mentions) Trypsin edta, by Thermo Fisher Scientific (28 mentions) Collagenase type 4, by Worthington (26 mentions) Hanks balanced salt solution (hbss), by Thermo Fisher Scientific (21 mentions) Collagenase type 1, by Worthington (20 mentions) Fetal bovine serum (fbs), by Thermo Fisher Scientific (20 mentions) Collagenase 1, by Worthington (20 mentions) Collagenase 2, by Worthington (18 mentions) Glutamax, by Thermo Fisher Scientific (17 mentions) Collagenase type 3, by Worthington (16 mentions) Penicillin streptomycin, by Thermo Fisher Scientific (15 mentions) Collagenase type 2, by Worthington (14 mentions) Collagenase d, by Roche (13 mentions) Hyaluronidase, by Merck Group (13 mentions) Facsaria 2, by BD (12 mentions) Neurobasal medium, by Thermo Fisher Scientific (12 mentions) Elastase, by Worthington (10 mentions) Collagenase, by Worthington (10 mentions) Collagenase dispase, by Roche (9 mentions)

420 protocols using dnase 1

Isolation of Decidua Mesenchymal Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

We have previously reported the isolation of DMSCs from the decidua basalis adhering onto the maternal side of the placenta [13 ]. About eight grams of placental tissue was dissected from the basal plate, washed four times in PBS, finely minced and digested in trypsin (0.25%; Life Technologies, CA, USA) and DNAse 1 (50 μg/mL; Worthington, NJ, USA) at 4°C overnight. Fetal bovine serum (FBS; Thermo Scientific, MA, USA) was added to inactivate the trypsin and the digest was centrifuged at 200g for 5 min. The pelleted tissue was digested in type 1 collagenase (10 mg/mL; Worthington) and DNAse 1 (50 μg/mL, Worthington) for 30 min at 37°C and strained through a 100 μm stainless steel sieve. The filtrate was layered over Histopaque (Sigma-Aldrich, MO, USA) and separated by density gradient centrifugation at 400g for 30 min. Mononuclear cell layers containing the DMSCs were aspirated and centrifuged at 200g for 5 min. DMSCs were maintained in α-MEM medium (Sigma-Aldrich) with 10% FBS, penicillin/streptomycin (100 U/mL and 100 mg/mL, respectively; Life Technologies) and 2 mM L-glutamine (Sigma-Aldrich). P0 DMSCs were passaged after reaching 80% confluence and cells were expanded up to P5.

Kusuma G.D., Menicanin D., Gronthos S., Manuelpillai U., Abumaree M.H., Pertile M.D., Brennecke S.P, & Kalionis B. (2015). Ectopic Bone Formation by Mesenchymal Stem Cells Derived from Human Term Placenta and the Decidua. PLoS ONE, 10(10), e0141246.

+ Open protocol

+ Expand

RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Identical volumes of RNA (representing approximately the same number of cells and ranging from 1 to 2 μg of RNA) were treated with 2 units of DNase I (Worthington) in DNase I buffer (10 mM Tris-HCl, pH 7.0, 10 mM NaCl, 2 mM MgCl₂ and 0.5 mM CaCl₂) for 15 min at room temperature to degrade any genomic DNA contamination. Afterwards, DNase I heat-inactivated at 75 °C for 10 min. Treated RNAs were reverse-transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). qPCR was performed using SYBR Supermix (Biorad) with ∼50 ng of cDNA as template. Data were normalized relative to measured HPRT levels.

Li L., Matsui M, & Corey D.R. (2016). Activating frataxin expression by repeat-targeted nucleic acids. Nature Communications, 7, 10606.

+ Open protocol

+ Expand

Isolation and Culture of Tooth Germ Mesenchymal Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

All animal studies were conducted following the guidelines approved by Institutional Animal Care and Use Committee (IACUC). Mandibles were isolated from euthanized newborn male CD1 mice. Mandibular molar tooth germs were retrieved from the surrounding tissue, rinsed by sterile phosphate‐buffered saline (PBS), and kept in 1.2 U/ml of DispaseII and incubated at 37°C for 40 minutes. After being washed in plain DMEM medium, epithelium and mesenchyme of the tooth germs were separated with fine needles. The Mesenchymal tissues were treated once with 0.25% trypsin (Sigma), 50 U/mL collagenase I and 20 U/mL DNase I for 10 minutes at 37°C; twice with 100 U/mL collagenase I (Worthington) for 10 minutes at 37°C; and once with 0.25% trypsin and 20 U/mL DNase I for 5 minutes at 37°C. The dissociated cells were plated in 6‐well cell culture plates after washed in complete DMEM, and then incubated for 24 hours at 37°C. Adherent cells were used as TGMCs. Aliquots were kept in a liquid nitrogen tank. All TGMCs used in this study were within 5 passages.

Luo W., Zhang L., Huang B., Zhang H., Zhang Y., Zhang F., Liang P., Chen Q., Cheng Q., Tan D., Tan Y., Song J., Zhao T., Haydon R.C., Reid R.R., Luu H.H., Lee M.J., El Dafrawy M., Ji P., He T, & Gou L. (2021). BMP9‐initiated osteogenic/odontogenic differentiation of mouse tooth germ mesenchymal cells (TGMCS) requires Wnt/β‐catenin signalling activity. Journal of Cellular and Molecular Medicine, 25(5), 2666-2678.

+ Open protocol

+ Expand

Isolation and Analysis of Lung and Lymphoid Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

At the indicated times, mice were euthanized by CO₂ inhalation followed by exsanguination by perforation of the abdominal aorta. Lungs were perfused by injecting 3 ml of PBS in the left ventricle of the heart. Cells in the lung airways were harvested after intratracheal introduction and recovery of 1 mL PBS three times. Single cells were prepared from draining lymph nodes (LNs) and spleen as described previously (9 ). Preparation of lung single-cell suspensions after enzymatic digestion was described elsewhere (14 ). Briefly, lungs were removed, minced, and incubated in digest media containing 250 U/ml collagenase type 1 (Worthington, Lakewood, NJ), 5 U/ml hyaluronidase (Sigma-Aldrich, St. Louis, MO), and 50 U/ml DNase I (Worthington) for 1 h at 37°C, and 2 mM EDTA was added for the last 15 min. The single-cell suspension was filtered through 40-μm pore cell strainers after removing erythrocytes by NH₄Cl hypotonic lysis buffer.
For the analysis of dendritic cell (DC) population, draining LNs were harvested, cut into small fragments, and digested with 2 mg/ml collagenase D (Roche, Mannheim, Germany) and 50 U/ml DNase I (Worthington) in HBSS with calcium and magnesium for 30min at 37°C, followed by the addition of 10 mM EDTA for a further 5 min.

Nagaoka M., Hatta Y., Kawaoka Y, & Malherbe L.P. (2014). Antigen signal strength during priming determines effector CD4 T cell function and antigen sensitivity during influenza virus challenge. Journal of immunology (Baltimore, Md. : 1950), 193(6), 2812-2820.

+ Open protocol

+ Expand

Isolation and Purification of Tumor-associated Immune Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Subcutaneous, orthotopic or MMTV-PyMT tumours were excised, cut in small pieces, treated with 10 U ml⁻¹ collagenase I, 400 U ml⁻¹ collagenase IV and 30 U ml⁻¹ DNaseI (Worthington) for 30 min at 37 °C, squashed and filtered. Red blood cells were removed using erythrocyte lysis buffer and density gradients (Axis-Shield) were used to remove debris and dead cells.
Tumour-draining LNs were cut, dissociated with 10 U ml⁻¹ collagenase I, 400 U ml⁻¹ collagenase IV and 30 U mL⁻¹ DNaseI (Worthington) for 45 min at 37 °C and filtered.
Spleens were flushed with 200 U ml⁻¹ collagenase III (Worthington) and left for 30 min at 37 °C. Afterwards, spleens were filtered and red blood cells were removed using erythrocyte lysis buffer.
To purify DC subpopulations from tumour, spleen or LNs, CD11c⁺ cells were MACS-enriched (anti-CD11c microbeads; Miltenyi) and sorted using BD FACSAria II (BD Biosciences) according to the gating strategy in Fig. 1a, Supplementary Fig. 6A or Supplementary Fig. 8A, respectively.
Bone marrow leukocytes were isolated through flushing of tibia and femur. The obtained cell suspensions were filtered, and red blood cells were removed using erythrocyte lysis buffer. To purify bone marrow monocytes, CD11b⁺ cells were MACS-enriched (anti-CD11b microbeads; Miltenyi) before sorting.

Laoui D., Keirsse J., Morias Y., Van Overmeire E., Geeraerts X., Elkrim Y., Kiss M., Bolli E., Lahmar Q., Sichien D., Serneels J., Scott C.L., Boon L., De Baetselier P., Mazzone M., Guilliams M, & Van Ginderachter J.A. (2016). The tumour microenvironment harbours ontogenically distinct dendritic cell populations with opposing effects on tumour immunity. Nature Communications, 7, 13720.

+ Open protocol

+ Expand

Nuclei Preparation and DNase I Digestion

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nuclei preparation and DNase I digestion were carried out as previously described with modifications [12] (link). Up to 2×10⁵ cells were lysed on ice in 2 ml ice-cold lysis buffer (10 mM Tris pH 7.4, 15 mM NaCl, 5 mM MgCl₂, 10 mM EDTA, 60 mM KCl, 0.2% NP-40, 0.5 mM DTT, 0.5 µM Spermidine, 300 mM sucrose) supplemented with 1× protease inhibitors (Roche). After 5 min on ice, 8 ml of lysis buffer containing 0.1 mM EDTA, no sucrose and protease inhibitors, was added to the tube, and the nuclei were centrifuged at 500 g for 10 min at 4°C with deceleration off. The nuclei were washed once in lysis buffer containing 0.1 mM EDTA, no sucrose and protease inhibitors, once in 1× DNase I buffer (15 mM NaCl, 5 mM MgCl₂, 60 mM KCl, 0.1 mM EGTA, 10 mM Tris-HCl, pH 7.4). The nuclei were then resuspended in 40 µl 1× DNase I buffer supplemented with 300 mM sucrose and transferred to a thin wall 200 PCR tube. Various amounts of DNase I (Worthington) diluted in 10 µl 1× DNase I buffer were added to the nuclei, and mixed 3 times with a large-orifice tip. The mixture was incubated on ice for 1 hr. At the end of the incubation, 50 µl of 1% low melt agarose (dissolved in 100 mM EDTA) was added and mixed with a large-orifice tip.

Zeng W.P, & McFarland M.M. (2014). Rapid and Unambiguous Detection of DNase I Hypersensitive Site in Rare Population of Cells. PLoS ONE, 9(1), e85740.

+ Open protocol

+ Expand

Dissociation of Prostate Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Prostate tissues were minced with scissors and then incubated in papain (20 units/ml) with 0.1 mg/ml DNase I (Worthington LK003150) at 37°C with gentle agitation. After 45 minutes, samples were gently triturated, then incubated for another 20-45 minutes in papain as needed.
Samples were gently triturated again, followed by quenching of the enzyme using 1 mg/ml ovomucoid/bovine serum albumin solution with 0.1 mg/ml DNase I (Worthington LK003150).

Crowley L., Cambuli F., Aparicio L., Shibata M., Robinson B.D., Xuan S., Li W., Hibshoosh H., Loda M., Rabadán R., & Shen M.M. (2020). A single-cell atlas of the mouse and human prostate reveals heterogeneity and conservation of epithelial progenitors.

+ Open protocol

+ Expand

Photoactive Oligonucleotide Synthesis and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

EC42 Template Strand (oligo gel purified)
5’GCCACCGCGGTCTAGAGGATCCCCGGGAGTGGAATGAGAAATGAGTGTGAAGATAGAGGAGAGATCAAAAAAATTA 3’
EC42 non-template strand (oligo, gel purified), size corresponding to desired position of photo-reactive nucleotide
5-Iodo-dCTP (Sigma-Aldrich)
alpha-³²P-dATP (6000 Ci/mmol, MP Biomedical)
dATP, dCTP, dTTP, dGTP nucleotide mix, 25 mM each
Klenow (exo-) fragment of DNA polymerase 10U/μl (NEB)
NEB buffer #2 (50 mM NaCl, 10 mM Tris-HCl pH 7.9, 10 mM MgCl₂1, 1 mM DTT)
G-50 prepared in TE
12% native PAGE in 1X TBE
Gel extraction buffer (500 mM NH₄OAc, 10 mM MgCl₂)
Siliconized glass wool
Transcription Buffer (50 mM HEPES-KOH pH 7.5, 100 mM KCl, 1 mM MnCl₂, 0.5 mM DTT, 10% glycerol, 0.3 mM UpG, 0.1 μg/μl BSA, 1 unit/μl RNasin)
Nucleotide mix (0.4 mM ATP, 0.4 mM UTP, 0.4 mM CTP, 0.02 mM 3’-0-MeGTP) Spectroline short wave UV (300 nm) lamp
10X DNase I buffer (100 mM MgCl₂, 50 mM CaCl₂, 100 mM Tris-HCl pH 8.0)
DNase I (Worthington) diluted to 10 units/μl in DNase I buffer
RNase A 5 mg/ml
3X SDS-PAGE loading buffer (180 mM Tris-HCl pH 6.8, 15% 2-mercaptoethanol, 6% SDS, 15% glycerol, 0.25% bromophenol blue)
SDS-PAGE running buffer (50 mM Tris-base, 500 mM Glycine, 0.2% SDS, pH 8.3)

Crickard J.B, & Reese J.C. (2019). Biochemical Methods to Characterize RNA Polymerase II Elongation Complexes. Methods (San Diego, Calif.), 159-160, 70-81.

+ Open protocol

+ Expand

Tumor Dissociation and Cell Isolation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tumor digestion media (TDM): 5 mg DNase I (Worthington), 12.5 mg collagenase P (Roche), 12.5 mg collagenase/dispase (Roche), 100 μl B27 (Invitrogen), 50 μl N2 (Invitrogen), made to 5 ml with Neural Basal medium (Invitrogen), followed by 0.22 μm filter sterilization. DNase solution (DS): 7.5 mg DNase I (Worthington), 120 μl 45% glucose solution (Sigma-Aldrich), up to 15 ml with 1× Basal Medium Eagle media (Invitrogen), followed by 0.22 μm filter sterilization. Percoll solution: Percoll (Sigma-Aldrich) was adjusted to a final pH of 7.4 followed by 0.22 μm filter sterilization. 35% Percoll (25 ml 4× PBS-EDTA, 35 ml Percoll, 40 ml water) and 60% Percoll (25 ml 4× PBS-EDTA, 60 ml Percoll, 15 ml water, 300 μl 0.4 % trypan blue (Invitrogen) stocks were prepared and stored at 4°C. Cytokines: IL-4, TNF, IFN-γ (all eBioscience), IL-13 (Peprotech) and LPS (Sigma-Aldrich) were used at 10 ng/ml, 10ng/ml, 2 ng/ml, 40 ng/ml or 100 ng/ml, respectively. Anti-mouse IL-13 antibody and IgG1 control (Clone MOPC-21) were provided by Genentech, Inc. and Bio X Cell, respectively.

Kratochvill F., Neale G., Haverkamp J.M., de Velde L.A., Smith A.M., Kawauchi D., McEvoy J., Roussel M.F., Dyer M.A., Qualls J.E, & Murray P.J. (2015). TNF counterbalances the emergence of M2 tumor macrophages. Cell reports, 12(11), 1902-1914.

+ Open protocol

+ Expand

DNase I Hypersensitive Sites Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNase I hypersensitive sites sequencing (DNaseI-seq) was performed as previously described.^{21 (link)} 3x10⁵ sorted cells were added directly to DNaseI (Worthington Biochemical Corporation) used between 6 and 13 U/mL for 3 minutes at 22°C. The reaction was terminated by addition of sodium dodecyl sulfate to 0.5% and cell lysates treated with 0.5 mg/mL proteinase K. DNA was isolated by phenol/chloroform extraction and used to generate a library using the KAPA hyper prep kit, according to the manufacturer’s instructions.

Kellaway S.G., Keane P., Kennett E, & Bonifer C. (2020). RUNX1-EVI1 disrupts lineage determination and the cell cycle by interfering with RUNX1 and EVI1 driven gene regulatory networks. Haematologica, 106(6), 1569-1580.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!