Brain RNA was reverse transcribed using the Superscript III complimentary DNA (cDNA) synthesis kit, random hexamers (Life Technologies), and an equal ratio of random hexamers and Oligo dT primers (Thermo Fisher Scientific). Real-time quantitative PCRs (qPCRs) were conducted using TaqMan gene expression assays and the QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems, Foster City, CA). All probes were purchased from Life Technologies: Tmem106a (Mm01246747_m1), Tmem106b (Mm00510952_m1), Tmem106c (Mm01303550_m1), Iba1 (Aif1; Mm00479862_g1), Gfap (Mm01253033_m1), and Gapdh (Mm99999915_g1).
Random hexamer
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom, Canada, France, Lithuania, Japan, Sweden, Italy, Spain, Australia, Switzerland
Random hexamers are short DNA sequences composed of six randomly arranged nucleotides. They are commonly used as primers in reverse transcription and PCR reactions to initiate the synthesis of complementary DNA (cDNA) from RNA templates.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (183 mentions)
Trizol, by Thermo Fisher Scientific (153 mentions)
Rneasy mini kit, by Qiagen (129 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (103 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (88 mentions)
Superscript 3, by Thermo Fisher Scientific (81 mentions)
Dnase 1, by Thermo Fisher Scientific (79 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (63 mentions)
Superscript 2, by Thermo Fisher Scientific (52 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (50 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (45 mentions)
Tri reagent, by Merck Group (35 mentions)
Rnaseout, by Thermo Fisher Scientific (35 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (33 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (32 mentions)
Rneasy kit, by Qiagen (29 mentions)
Rnase inhibitor, by Thermo Fisher Scientific (29 mentions)
Dntps, by Thermo Fisher Scientific (28 mentions)
Iq sybr green supermix, by Bio-Rad (26 mentions)
Ribolock rnase inhibitor, by Thermo Fisher Scientific (26 mentions)
967 protocols using random hexamer
1
Gene Expression Analysis of Neural Markers
2
RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All leaves were from natural conditions in paddy fields. Leaves were homogenized in liquid nitrogen and stored for a short time. Total RNA was isolated using TRIZOL® reagent (Invitrogen, CA, USA) and purified using Qiagen RNeasy columns (Qiagen, Hilden, Germany).
Reverse transcription was performed using Moloney murine leukemia virus (M-MLV; Invitrogen). A total volume of 10 μL containing 2 μg total purified RNA and 20 pmol random hexamers (Invitrogen) was heated at 70°C for 2 min and then chilled on ice for 2 min. M-MLV and the reaction buffer were added to a total volume of 20 μL containing 200 units of M-MLV, 20 pmol random hexamers, 500 μM dNTPs, 50 mM Tris-HCl (pH 8.3), 3 mM MgCl2, 75 mM KCl, and 5 mM dithiothreitol, and samples were then heated at 37°C for 1.5 h.
cDNA samples were diluted to 2 ng/μL for qRT-PCR assays performed on 1 μL of each cDNA dilution using SYBR Green Master Mix (Applied Biosystems, PN 4309155). The relative quantification method (ΔΔCT) was used to evaluate quantitative variation between replicates examined (Livak and Schmittgen, 2001 (link)). Primers for specific genes are listed inTable S7 .
Reverse transcription was performed using Moloney murine leukemia virus (M-MLV; Invitrogen). A total volume of 10 μL containing 2 μg total purified RNA and 20 pmol random hexamers (Invitrogen) was heated at 70°C for 2 min and then chilled on ice for 2 min. M-MLV and the reaction buffer were added to a total volume of 20 μL containing 200 units of M-MLV, 20 pmol random hexamers, 500 μM dNTPs, 50 mM Tris-HCl (pH 8.3), 3 mM MgCl2, 75 mM KCl, and 5 mM dithiothreitol, and samples were then heated at 37°C for 1.5 h.
cDNA samples were diluted to 2 ng/μL for qRT-PCR assays performed on 1 μL of each cDNA dilution using SYBR Green Master Mix (Applied Biosystems, PN 4309155). The relative quantification method (ΔΔCT) was used to evaluate quantitative variation between replicates examined (Livak and Schmittgen, 2001 (link)). Primers for specific genes are listed in
3
Placental Transcriptome RNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from homogenized placental tissue using the RNeasy Mini Kit (Qiagen, Valencia, CA) and stored in RNAse-free water at −80 °C. The yield was quantified using a Quibit Fluorometer (Thermo Scientific, Waltham, MA) and the integrity was assessed using an Agilent Bioanalyzer (Agilent, Santa Clara, CA). Ribosomal RNA was removed using a Ribo-Zero Kit [57 ]. RNA was converted to cDNA using random hexamers (Thermo Scientific, Waltham, MA). Transcriptome-wide 50 bp single-end RNA sequencing was conducted using the HiSeq 2500 platform (Illumina, San Diego, CA) [58 ]. Samples were run in three sequencing batches, with 10% of the samples run in triplicate within each batch.
4
Quantification of mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The extraction of the total mRNA was done using the RNase Mini Kit (Qiagen, 74104) following the manufacturer's instructions (Table 2 ). On P7 collected brains, 3 μg mRNA from the three regions of interest at P7 (CTL; n = 6, IUGR; n = 6 and IUGR_Lf; n = 6) and P21 (CTL; n = 6, IUGR; n = 8 and IUGR_Lf; n = 8) were reverse transcripted to cDNA using 400 units of Moloney murine leukemia virus reverse transcriptase (Invitrogen, 28025-013), 20 units of recombinant RNAsin (Promega, N2515), 0.5 μg of random hexamers (ThermoFischer Scientific, #S0142), 2 mmol/L dNTP (Invitrogen, 10297018), and 40 mmol/L of dithiothreitol (Invitrogen, 18080093). Real-time quantitative PCR was performed with the PowerUp SYBR Green Master Mix (Applied Biosystems, A25742) and using an StepOnePlus™Real-Time PCR System (Applied Biosystems). Gene expressions were normalized using the housekeeping ribosomal gene RPS29. The results were calculated using the Livak approach and are expressed in arbitrary units (A.U) (12 (link)).
5
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 1.5 μg RNA was harvested using the PureLink RNA Mini Kit (Ambion) following the manufacturer's instructions. SuperScript IV Reverse Transcriptase was used for the conversion of approximately 150 ng of RNA to cDNA, along with RNaseOut, 10 mM dNTPs, and 50 μM Random Hexamers (ThermoFisher, Pittsburgh, PA), also following the manufacturer's instructions.
6
Quantifying Cat ACE2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 50–100 mg of organ samples from nasal mucosa, trachea, or lung was mechanically disrupted by cutting before 1 mL TRIzol reagent (Invitrogen, Waltham, MA, USA) was added. Samples were incubated for 5 min at room temperature, followed by homogenisation using a bead-beating tissue homogeniser. RNA was extracted using TRIzol reagent. RNA was used as a template for cDNA synthesis using the SuperScript III First-Strand Synthesis System and random hexamers (Thermo Fisher Scientific, Waltham, MA, USA). Finally, cDNA was subjected to qPCR using SYBR Green Mastermix (Thermo Fisher Scientific, Waltham, MA, USA), and primers targeting cat ACE2 (for: CAAGCACTTACAATTGTTGGAA, rev: TGAGTAATCATTAGCAACATGGAA). Cycle threshold (ct) values were normalised to total RNA. Dilution series of expression plasmids containing cat ACE2 were used as standards to calculate the amounts of genomic equivalents (GE) based on the ct values.
7
Placental RNA Isolation and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from placental samples using the RNeasy Mini Kit (Qiagen, Valencia, CA) and stored in RNAse-free water at −80°C (12 (link)). Yields were quantified using a Qubit Fluorometer (Thermo Scientific, Waltham, MA) and an Agilent Bioanalyzer was used to assess integrity (Agilent, Santa Clara, CA). Ribosomal RNA was removed using a Ribo-Zero Kit (39 (link)), with the remaining RNA converted to cDNA using random hexamers (Thermo Scientific, Waltham, MA). The HiSeq 2500 platform (Illumina, San Diego, CA) (40 (link)) was used to assess transcriptome-wide 50 bp single-end RNA-seq, which was conducted in three sequencing batches and samples were randomized across batches; 10% of samples within each batch were run in triplicate.
8
Optimized RT-qPCR Template Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Template RNA was diluted in 1 μL of lysis buffer, denatured for 1.5 min at 70 °C, and stored on ice. The reaction buffer for RT was modified using the PrimeScript RT reagent Kit (TaKaRa). A mixture containing 2 μL of conventional RT mix (1.5× PrimeScript buffer, 0.6 pmol oligo(dT)18 (Thermo Fisher), 8 pmol random hexamers (TaKaRa), and 1.5× PrimeScript enzyme mix in RNase-free water) or 2 μL of RT-RamDA mix (1.5× PrimeScript buffer, 0.6 pmol oligo(dT)18, 8 pmol random hexamers or NSRs, 0.2 U of DNase I Amplification Grade (Thermo Fisher), 100 ng of T4 gene 32 protein (Roche), and 1.5× PrimeScript enzyme mix in RNase-free water) was added to 1 μL of diluted, denatured template RNA. The mixture was agitated for 30 s at 2000 rpm using MixMate (Eppendorf) and incubated in a C1000 thermal cycler (Bio-Rad) at 25 °C for 10 min, 30 °C for 10 min, 37 °C for 30 min, 50 °C for 5 min, and 85 °C for 5 min. The RT product was diluted 1:9 in nuclease-free water and used for qPCR analysis.
9
Cardiac Gene Expression Analysis
10
Quantification of Ferret Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from nasal wash cells using the RNeasy Mini Kit (Qiagen) and cDNA were synthesized using the Verso cDNA Synthesis Kit and random hexamers as primer (Thermo Scientific). Quantitative PCR was performed using ferret IFN-γ, IL-12p40, TNF-α, and GAPDH gene specific primers [21 (link)] and RT2 SYBR Green qPCR Master Mix (SABioscience) in MX3005P thermocycler as previously described [18 (link)]. Ct values for cytokines were normalized to GAPDH and their expressions relative to basal samples were calculated using 2(-ΔΔCt) formula.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!