Nucleobond xtra bac kit

Manufactured by Macherey-Nagel

Sourced in Germany

The NucleoBond Xtra BAC kit is a laboratory product designed for the large-scale isolation and purification of bacterial artificial chromosome (BAC) DNA. It utilizes a silica-based anion-exchange technology to efficiently capture and purify high-quality BAC DNA from bacterial cultures.

Automatically generated - may contain errors

Lab products found in correlation

Dh10bac e coli, by Thermo Fisher Scientific (3 mentions) Esf 921 media, by Expression Systems (3 mentions) Cellfectin 2, by Thermo Fisher Scientific (3 mentions) Amaxa nucleofector, by Lonza (1 mentions) Effectene transfection reagent, by Qiagen (1 mentions) Bioprime dna labeling system, by Thermo Fisher Scientific (1 mentions) Chloramphenicol, by Merck Group (1 mentions)

16 protocols using nucleobond xtra bac kit

Construction of HCMV lncRNA Mutant Viruses

Check if the same lab product or an alternative is used in the 5 most similar protocols

HCMV lncRNA-Mut was constructed from HCMV Toledo BAC (GenBank AC146905.1) using a counter-selection BAC modification kit (Gene Bridge), according to manufacturer protocol. Briefly, a target region in the Toledo BAC DNA was replaced with a prokaryotic selectable marker, rpsL-neo^R, by homologous recombination. PCR products with flanking sequences homologous to the target regions were introduced by electroporation (1652660; Bio-Rad). BAC clones with an rpsL-neo^R cassette were selected using kanamycin and verified by PCR. For RNA1.2 and RNA2.7, the lncRNA sequences were completely replaced with the cassette. RNA4.9 sequences, excluding oriLyt, were also replaced with the cassette. For RNA5.0, the cassette was replaced with sequences harboring modified splice donor sites (AG-GT → CT-CG). The modified regions were replaced with the original lncRNA sequences and successful clones were selected using streptomycin. The primers used for BAC recombination are listed in Supplementary Table 5. PCR- and sequencing-verified BAC clones were extracted using the NucleoBond Xtra BAC kit (740436; Macherey–Nagel). Recombinant BACs were transfected into primary HFFs for propagation, as described in “Viral infection”.

Lee S., Kim H., Hong A., Song J., Lee S., Kim M., Hwang S.Y., Jeong D., Kim J., Son A., Lee Y.S., Kim V.N., Kim J.S., Chang H, & Ahn K. (2022). Functional and molecular dissection of HCMV long non-coding RNAs. Scientific Reports, 12, 19303.

+ Open protocol

+ Expand

HCMV Strain Production and Infection

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The HCMV strain TB40/E WT and the deletion mutant TB40/E ∆US28 were previously described [53 (link)]. HCMV strain Merlin was generated from a bacterial artificial chromosome BAC pAL2157. This is BAC pAL1498 [49 (link)] in which eGFP was linked to the IE2 gene using a P2A linker. SW102 E. coli containing BAC pAL2157 were kindly provided by Dr. Richard J. Stanton. BAC DNA was isolated using NucleoBond Xtra BAC kit (Macherey Nagel, Düren, Germany). Virus production was initiated by electroporation of BAC DNA into HFFF TR cells using the Amaxa Nucleofector and the basic fibroblast nucleofector kit (Lonza, Basel, Switserland). Subsequent virus productions in HFFF TR cells were started with an infection at MOI 0.02 and titres were determined after 3 days using immediate early antigen staining. U251 and GBM48 GBM cells were infected at MOI 3.

Heukers R., Fan T.S., de Wit R.H., van Senten J.R., De Groof T.W., Bebelman M.P., Lagerweij T., Vieira J., de Munnik S.M., Smits-de Vries L., van Offenbeek J., Rahbar A., van Hoorick D., Söderberg-Naucler C., Würdinger T., Leurs R., Siderius M., Vischer H.F, & Smit M.J. (2018). The constitutive activity of the virally encoded chemokine receptor US28 accelerates glioblastoma growth. Oncogene, 37(30), 4110-4121.

+ Open protocol

+ Expand

Screening and Characterization of Barley BAC Clones

Check if the same lab product or an alternative is used in the 5 most similar protocols

A total of 115,200 clones of the HVVMRXALLhB BAC library of barley were screened at the French Plant Genomic Resources Centre (INRA-CNRVG) at Toulouse (France). Radioactively labelled oligo (ACT)₅ was used as a probe. Clones with strong signals were selected and their DNA purified using the NucleoBond Xtra BAC kit (Macherey-Nagel).
Southern blot experiments were conducted to characterize the clones. One microgram of DNA of each clone was digested with EcoRI, HindIII, BamHI, KpnI, BglII and SalI restriction enzymes. Fragments were electrophoresed on 0.8% agarose gels and transferred to a nylon membrane. Hybridization was performed using digoxigenin-labelled (ACT)₅ oligo as a probe. Positive fragments were subcloned into a SmaI site (blunt) on the pJAZZ linear vector (Lucigen) using the BigEasy v2.0 Linear Cloning Kits (Lucigen) following the manufacturer’s instructions. End sequencing of each subclone was performed using the vector primers SL-1 and NZ provided with the kit.

De Bustos A., Cuadrado A, & Jouve N. (2016). Sequencing of long stretches of repetitive DNA. Scientific Reports, 6, 36665.

+ Open protocol

+ Expand

Generation of ERα-ZsGreen BAC Transgenic Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

A BAC clone (#RP23-283O2) was obtained from BAC PAC Resource Center at Children’s Hospital Oakland Research Institute (CHORI). This BAC clone was derived from the C57BL/6J mouse strain and covers exon 1 to 4 of ERα gene. ZsGreen1 cDNA was prepared from pIRES-ZsGreen1 plasmid (Clontech, Mountain View, CA). The engineering of BAC transgenic vector was conducted in E. coli DH10B cells, using the Counter-Selection BAC Modification Kit (Gene Bridges, Heidelberg, Germany) following the manufacturer’s manual. As illustrated in Figure 1, the ZsGreen cDNA was introduced into translation start site in exon 2 of the ERα gene in the BAC clone.
Large scale of the recombinant ERα-ZsGreen BAC DNA was prepared by NucleoBond Xtra BAC Kit (Macherey-Nagel, Germany), which were linearized by PI-SceI digestion, purified with phenol-chloroform, precipitated with ethanol. Transgenic mice were obtained by injecting the linearized ERα-ZsGreen BAC DNA into pronuclei of C57BL/6 mice in the Genetically Engineered Mouse Core at Baylor College of Medicine. ERα-ZsGreen founders were maintained at a C57BL/6 background. Tail biopsies were used for the genotyping on PCR with primers Esr1ATG-393 F 5’-CCAGCAGCGAAGACCTGGAAAGT-3’ and ZsGr+236 R 5’ – ATGTCCTGGGGGTACTCGGTGAA-3’ producing the amplicon of 629 bp long.

Saito K., He Y., Yan X., Yang Y., Wang C., Xu P., Hinton AO J.r., Shu G., Yu L., Tong Q, & Xu Y. (2015). Visualizing estrogen receptor-α-expressing neurons using a new ERα-ZsGreen reporter mouse line. Metabolism: clinical and experimental, 65(4), 522-532.

+ Open protocol

+ Expand

HCMV-US28-pHluorin Recombinant BAC

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

SW102 E. coli carrying the HCMV Merlin BAC pAL1502, a variant of BAC pAL1498⁴⁰ (link) lacking the eGFP tag, were acquired from Dr. Richard J. Stanton. Recombineering was performed using galK positive/negative selection as previously described by Warming et al.⁵⁸ (link) Adaptations to the protocol used to generate the HCMV-US28-pHluorin Merlin BAC recombinant are specified below. The galK expression cassette was amplified from pgalK (Fredrick National Laboratory for Cancer Research) by PCR using oligonucleotide primers with homology arms flanking the pHluorin insertion site between Y179 and L180 of the US28: 5′-ttatggtggtgaccaaaaaagacaatcaatgtatgaccgactacgactaccctgttgacaattaatcatcggca-3′ and 5′-gcaccgagcatgagttctacgttgaggatgatcgggtaactgacctctaatcagcactgtcctgctcctt-3’.
To remove galK and generate HCMV-US28-pHluorin, pHluorin was amplified by PCR using oligonucleotide primers with homology arms flanking the insertion site: 5′-ttatggtggtgaccaaaaaagacaatcaatgtatgaccgactacgactacagatctctagccaccatgggaag-3′ and 5′- gcaccgagcatgagttctacgttgaggatgatcgggtaactgacctctaaagatctgattcgagctccaccg-3’. BAC DNA was isolated using NucleoBond Xtra BAC kit (Machery Nagel).

Bebelman M.P., Setiawan I.M., Bergkamp N.D., van Senten J.R., Crudden C., Bebelman J.P., Verweij F.J., van Niel G., Siderius M., Pegtel D.M, & Smit M.J. (2023). Exosomal release of the virus-encoded chemokine receptor US28 contributes to chemokine scavenging. iScience, 26(8), 107412.

+ Open protocol

+ Expand

Baculovirus Production from Recombinant Bacmid

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein expression constructs in pFastBac1 were transformed into DH10Bac E. coli (Thermo Fisher, Cat. # 10361012) and selected on Luria broth agar with 50μg/mL kanamycin, 15μg/mL gentamycin, 0.5 mM isopropyl-thiogalactopyranoside (IPTG) and 20 μg/mL X-gal at 37°C. White colonies, indicating recombinants, were grown in LB broth and the recombinant bacmid DNA was prepared using the NucleoBond Xtra Bac Kit (Machery Nagel, Cat. #740436.25). 1μg of recombinant bacmid DNA was combined in 1 mL of ESF-921 media (Expression Systems, Cat. #96-001-01) with 20 μL of Cellfectin II (Thermo Fisher, Cat. #10362100) and added to 1×10⁶ adherent Sf9 cells. Cells were incubated for five days. Cell supernatants were clarified by centrifugation at 1500×g for 5 minutes. 0.5 mL of transfected cell supernatant was used to amplify the baculoviruses on 5×10⁶ adherent Sf9 cells for 5 days. First virus passage supernatants were clarified by centrifugation. 1 mL of first passage supernatant was used to further amplify the baculovirus on 50 ×10⁶ suspension Sf9 cells and incubated for 5 days.

Kirchdoerfer R.N., Bhandari M., Martini O., Sewall L.M., Bangaru S., Yoon K.J, & Ward A.B. (2020). Structure and immune recognition of the porcine epidemic diarrhea virus spike protein. Structure (London, England : 1993), 29(4), 385-392.e5.

+ Open protocol

+ Expand

BAC Transfection and G418 Selection

Check if the same lab product or an alternative is used in the 5 most similar protocols

BACs were purified using the NucleoBond Xtra BAC kit (Macherey Nagel) and transfected into HeLa Kyoto with the Effectene Transfection Reagent (QIAGEN) using the kit’s standard procedures. 24 hr after transfection, cells were trypsinised and diluted into passaging medium containing 300 μg/ml G418 (Serva) in order to select for single clones harboring the transfected BAC. Positive clones were screen for by Western Blot and Live cell imaging.

Zhang K., Foster H.E., Rondelet A., Lacey S.E., Bahi-Buisson N., Bird A.W, & Carter A.P. (2017). Cryo-EM Reveals How Human Cytoplasmic Dynein Is Auto-inhibited and Activated. Cell, 169(7), 1303-1314.e18.

+ Open protocol

+ Expand

Multicolor Fluorescent Probes from BAC DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Using the subunit sequences library, 14 fluorescent probes were designed (Supplemental Table S2).
For each of these 14 subunits, long-range PCR primer pairs were designed, producing amplicons between 2946 and 9794 bp (Supplemental Table S2). PCR reactions were performed with the TAKARA LA v2 kit (Takara Bio) using the standard gDNA protocol. Template gDNA was extracted from the same cell line for all reactions, to reduce amplicon variation between batches.
BAC clones were obtained from BacPac Resources (CHORI) as E. coli stab cultures, which were grown according to recommendations. BAC DNA was extracted using the Nucleobond Xtra BAC kit (Macherey-Nagel).
Subunit PCR Amplicons and BAC DNA were purified and antibody-labeled by random prime amplification (BioPrime DNA Labeling System; Invitrogen). An indirect detection system with primary labels Biotin-dUTP, Digoxigenin-dUTP, and Fluorescein-dUTP was used. The use of three labels allowed production of six detectable probe colors: three of each label separately and three of each pairwise combination.

Demaerel W., Mostovoy Y., Yilmaz F., Vervoort L., Pastor S., Hestand M.S., Swillen A., Vergaelen E., Geiger E.A., Coughlin C.R., Chow S.K., McDonald-McGinn D., Morrow B., Kwok P.Y., Xiao M., Emanuel B.S., Shaikh T.H, & Vermeesch J.R. (2019). The 22q11 low copy repeats are characterized by unprecedented size and structural variability. Genome Research, 29(9), 1389-1401.

+ Open protocol

+ Expand

Transgenic Mouse Line Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Tg(Jpx) and Tg(Jpx, Xist) transgene constructs were subcloned from a BAC8 transgene [35 (link),36 (link)]. DNA was purified using a Macherey-Nagel NucleoBond Xtra BAC kit. Pronuclear injection of DNA into B6SJLF1/J donor embryos was performed at the UCI Transgenic Mouse Facility. Transgenic founder animals were crossed with C57BL/6J wildtype mice to establish individual transgenic lines. Crosses performed were WT/WT x TG/WT (TG: Transgenic; founders of both sexes were obtained and used as transgenic donors). Mice were identified as transgenic by genomic PCR on toe DNA using a primer set against the BAC8 vector sequence [36 (link)]. Mouse gender was determined by priming to the UBEX gene [37 (link)].

Carmona S., Lin B., Chou T., Arroyo K, & Sun S. (2018). LncRNA Jpx induces Xist expression in mice using both trans and cis mechanisms. PLoS Genetics, 14(5), e1007378.

+ Open protocol

+ Expand

Constructing Long Transposon Donor Vector

Check if the same lab product or an alternative is used in the 5 most similar protocols

All vectors were constructed using either a ligase reaction kit (Nippon Gene, Tokyo, Japan, or Takara, Kyoto, Japan) or the In-Fusion reaction kit (Takara). In the case of long transposon donor vector loading BAC (Fig. 5a), a template vector was first constructed by joining six fragments using an In-Fusion reaction after providing each fragment with polymerase chain reaction or annealing 2-oligo DNAs. The contents of this template vector are depicted at the bottom of Fig. 5a. Here, 70-bp and 134-bp arms homologous to the BAC vector (pBACe3.6) were placed in its flanking regions. The NotI/BstXI (FastDigest from Thermo Scientific)-digested fragment of this template vector was introduced into an E. coli BAC clone B6Ng01-263 N07 (RIKEN BioResource Center (BRC)) by electroporation, and a homologous recombination reaction was conducted by the RED/ET system (Gene Bridges, Heidelberg, Germany) to obtain the long transposon donor vector (Fig. 5a).
The long transposon donor vector was then purified using the NucleoBond Xtra BAC kit (Macherey-Nagel, Takara). Other vectors were purified with CsCl-gradient ultracentrifuge sedimentation after purification with an alkaline lysis solution method.

Tagaya H., Ishikawa K., Hosokawa Y., Kobayashi S., Ueoka Y., Shimada M., Ohashi Y., Mikami H., Yamamoto M., Ihara T., Kumazawa K., Sugihara K., Goshima N., Watanabe S, & Semba K. (2019). A method of producing genetically manipulated mouse mammary gland. Breast Cancer Research : BCR, 21, 1.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!