Transscript all in one first strand cdna synthesis supermix for qpcr

Total RNA was isolated using Trizol reagent (TaKaRa, Japan) and treated with RNase-free DNase I (TaKaRa, Japan) to remove genomic DNA contamination. The cDNA synthesis and reverse transcription-PCR were conducted using TransScript All-in One First-Strand cDNA Synthesis SuperMix for qPCR (TRANSGEN, China). Quantitative real-time PCR (qRT-PCR) was performed in three technical replicates using Super Real PreMix Plus (SYBR Green) (TIANGEN, China) with an Applied Biosystems^® 7500 Real-Time PCR System. The soybean CYP2 (Glyma.12g024700) gene was used for normalization (Zhang et al., 2019 (link)). The primers used for qRT-PCR are listed in Supplementary Table 4.

Briefly, PAO1 were cultured in a 6-well plate and treated with or without CD437 for 24 h, and RNA was isolated using E.Z.N.A. Total RNA Kit II (Omega Bio-tek, Norcross, GA, United States), cDNA was prepared using TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (Transgene, Beijing, China), qPCR was performed using TransStart Tip Green qPCR SuperMix (Transgene, Beijing, China), primers were used as follows: PslA-forward, CGCTCACGGTGATTATGTTC; PslA-reverse, TACATGAACAACAGCAGGCA; PelA-forward, ACAGCCAGGTAATGGACCTC; and PelA-reverse, AAGCTGTCCAGGGTATCGAG (Kim et al., 2015 (link)). All qPCR reactions were run in triplicate using a CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories Ltd., Hemel Hempstead, United Kingdom), the following conditions were utilized: 94°C for 5 s, 40 cycles of 94°C for 5 s, 58°C for 15 s, and 72°C for 10 s, Fold change of each gene was normalized to that of the 16S RNA of P. aeruginosa. The untreated samples were used for calibration.

The samples TPs, STs and YSs of Guomai 301 were prepared at 5 time points for real-time PCR. The intervals of the TP samples were seven days from 30 December 2016 to 27 January 2017. The intervals of the ST and YS samples were seven days from 1th March 2017 to 29 March 2017. Among them, the samples prepared at the first time point were used for RNA-seq. All primers were designed using Primer Premier 5.0 (http://www.premierbiosoft.com/primerdesign/index.html). The information of primers was listed in Table S1. Reverse transcription was performed using TransScript^® All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TransGen Biotech, Beijing, China). Real time - quantitative reverse transcription PCR (qRT-PCR) was performed using TransStart^® Top Green Qpcr SuperMix (2×) (TransGen Biotech, Beijing, China) according to the manufacturer’s protocol on the CFX Connect^TM Real-Time System (Bio-Rad, Hercules, CA, USA). The ingredients of the reaction system were strictly carried out according to the instructions. The wheat actin gene was used as an internal control gene. The qRT-PCR reactions were performed in 20 µL volumes [6 (link)]. The gene expression levels were calculated according to the 2^−ΔΔCT method [71 (link)].

The total RNA was extracted with the RNAprep Pure Plant Plus Kit (Cat DP441, Tiangen, China) according to the manufacturer’s protocol. The concentration and quality of RNA samples were detected on a Nanodrop 2000 (Thermo Scientific, Waltham, MA, USA). cDNA was prepared with the one-step cDNA Synthesis Kit (Cat AT311, Transgen, China), which was used for DobHLH gene amplification in yeast two hybrid assays. A sample of 200 ng of total RNA in a reaction system of 20 μL was converted to cDNA with TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (Cat AT341, Transgen, China), which was used for qRT-PCR assays.

The six samples of Shengnong 1 and NWMS1 at the S1, S2, and S3 stages were prepared for real-time PCR. The experimental samples were consistent with the samples of RNA-seq. All primers were designed using Primer Premier 5.0 software (www.premierbiosoft.com/primerdesign/index.html). The information of primers is listed in Table S6. Reverse transcription was performed using TransScript^® All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TransGen Biotech, Beijing, China). Real time qRT-PCR was performed using TransStart^® Top Green Qpcr SuperMix (2×) (TransGen Biotech, Beijing, China), according to the manufacturer’s protocol on CFX ConnectTM Real-Time System (Bio-Rad, Hercules, CA, USA). The ingredients of the reaction system were strictly carried out according to the specified instructions. The reaction of quantitative RT-PCR and semi-quantitative RT-PCR were performed in 20 µL volumes [88 (link)]. The gene expression levels were calculated according to the 2^−∆∆Ct method [95 (link)]. The wheat actin gene was used as an internal control.