Total RNA was isolated using the RNAiso Plus (TaKaRa, Japan) according to the manufacturer’s instructions. cDNA was synthesized using the PrimeScript RT Reagent Kit (Takara, China) and microRNA First-Strand cDNA Synthesis Kit (Sangon Biotech, China). The expression of circRNA and mRNA in cancer samples and cell lines was performed on an ABIPRISMVR 7300 Sequence Detection System (Applied Biosystems). Each reaction was performed in triplicate. Additional file 1 Table S1 lists the specific primers.
Microrna first strand cdna synthesis kit
Manufactured by Sangon
Sourced in China
The MicroRNA First-Strand cDNA Synthesis Kit is a lab equipment designed for the reverse transcription of microRNA molecules into complementary DNA (cDNA) for downstream analysis. The kit includes all the necessary reagents and components required for the conversion of microRNA into cDNA.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Primescript rt reagent kit, by Takara Bio (5 mentions)
Micrornas quantitation pcr kit, by Sangon (3 mentions)
Rnaiso plus, by Takara Bio (2 mentions)
Sybr green master mix, by Takara Bio (2 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Abiprismvr 7300 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Micrornas qpcr kit, by Sangon (1 mentions)
Sanprep column microrna extraction kit, by Sangon (1 mentions)
Rnaprep pure cell kit, by Tiangen Biotech (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent, by Takara Bio (1 mentions)
Sybr green pcr kit, by Takara Bio (1 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
Applied biosystems 7300 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Revertaid first strand cdna synthesis kit, by Sangon (1 mentions)
Trizol, by Takara Bio (1 mentions)
Sybr master mix, by Takara Bio (1 mentions)
Biorad icycler iq5, by Bio-Rad (1 mentions)
Goscript reverse transcription system kit, by Promega (1 mentions)
17 protocols using microrna first strand cdna synthesis kit
1
Profiling circRNA and mRNA Expression in Cancer
2
Profiling Gene and miRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated using TRIzol Reagent (Invitrogen) under the instructions. Subsequently, reverse-transcription was performed by PrimeScript RT Reagent Kit (TaKaRa, Dalian, China) and microRNA First-Strand cDNA Synthesis Kit (Sangon Biotech, China). SYBR Green Master Mix (TaKaRa) was used for gene amplification. Gene expressions were normalized by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 and calculated by 2−∆∆Ct method. The primers were listed in Table 1 .
The primer sequences used for qRT-PCR
| Gene | Forword primers (5′–3′) | Reverse primers (5′–3′) |
|---|---|---|
KCNQ1OT1 SORBS2 miR-18b-5p TGF-β1 Twist NF-κB STAT3 GAPDH U6 | CCTCCCTCACTGAGCTTTGG GATAAATGAATAATTCTCTTTGATG TGTGCAAATCCATGCAAAACTGA TACCATGCCAACTTCTGTCTGGGA GGCCAGGTACATCGACTT CGTAAAAGGACATATGAGAC CAGCAGCTTGACACACGGTA GCTGCTGAGTATGTCGTGGAGT GCTTCGGCAGCACATATACTAAAA | GTGCGGACCCTATACGGAAG AATTACCTGGAAGCCAGGTATGAA GTGCAGGGTCCGAGGT ATGTTGGACAACTGCTCCACCTTG TCCAGACCGAGAAGGCGTAG TGGTGGGAAACTCATCATAG AAACACCAAAGTGGCATGTGA AGTCTTCTGGGTGGCAGTGAT CGCTTCACGAATTTGCGTGTCAT |
3
RNA Isolation and Quantitative RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol (Invitrogen, USA) was used to prepare the total RNA of cells. An RNAprep Pure Cell Kit (Tiangen Biotech, Beijing, China) and Super M-MuLV First Strand cDNA Synthesis Mix (Sangon Biotech, Shanghai, China) were used for mRNA isolation. MiRNA was prepared with a SanPrep Column microRNA Extraction Kit and a microRNA First Strand cDNA Synthesis Kit (Sangon Biotech). 2X SYBR Abstract PCR Mix and MicroRNAs qPCR Kit (Sangong Biotech) were used for RT-PCR. The thermal cycling protocol used for quantitative RT‒PCR was as follows: predenaturation at 94 °C for 5 min, 40 cycles of denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s, and extension at 72 °C for 30 s. The primer sequences are listed in Supplementary Table S3 .
4
Analysis of circANKIB1, ANKIB1, and miR-217 expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in tissue specimens and cell lines was extracted with TRIzol reagent (Invitrogen). Subsequently, extracted RNA was reverse transcribed into complementary DNA (cDNA) using the Primescript RT Reagent (TaKaRa, Kusatsu, Japan) for analysis of circANKIB1, ANKIB1 and PAX3, or using microRNA First-Strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China) for detection of miR-217. After that, qRT-PCR reactions were performed using the SYBR Green PCR Kit (TaKaRa) on CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). In this study, the following primers were used for qRT-PCR: circANKIB1 (Forward, 5′-GGACACCTCTTCTGCTGACT-3′; Reverse, 5′-GAACACCTGATCGTTGGCAG-3′), ANKIB1 (Forward, 5′-GGAAAAGGACACCTCTTCTGCTG-3′; Reverse, 5′-CTCGTAGGCTTCACTAACTCCC-3′), miR-217 (Forward, 5′-TTGAGGTTGCTTCAGTGA-3′; Reverse, 5′-GGAGTAGATGATGGTTAGC-3′), PAX3 (Forward, 5′-TGATCGGAACACTGTGCCCTC-3′; Reverse, 5′-GCTTTCAACCATCTCATTCCGG-3′), β-Actin (Forward, 5′-GACCTCTATGCCAACACAGT-3′; Reverse, 5′-AGTACTTGCGCTCAGGAGGAG-3′), U6 (Forward, 5′-GTGCGTGTCGTGGAGTCG-3′; Reverse, 5′-AACGCTTCACGAATTTGCGT-3′). The expression levels of circANKIB1, ANKIB1, PAX3, and miR-217 were evaluated by 2-ΔΔCt method, followed by normalizing to β-Actin or U6. All experiments are performed for three times.
5
Quantitative Analysis of mRNA and miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen, CA, USA) was used to isolate total RNA from the cells following the manufacturer’s guidelines. The RNA was converted into cDNA by reverse transcription using the microRNA First-Strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China) and RevertAid First Strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China). Real-time PCR was performed to detect the RNA expression using SYBR Green PCR Master Mix (Applied Biosystems) and running with the Applied Biosystems 7300 Fast Real-Time PCR System (Applied Biosystems). The miRNA expression level was standardized to U6, and the mRNA expression level was standardized to GAPDH. The results were analyzed by the 2−△△Ct method. The primer sequences used in this study are described in Table.1 .
Primer sequences used in this study
| Primer name | Primer sequence |
|---|---|
| GAPDH | F: 5′-GGTTGTCTCCTGCGACTTCA-3′ |
| R: 5′-TGGTCCAGGGTTTCTTACTCC-3′ | |
| LICAM | F: 5′-TGCTCCTCATCCTGCTCATCCTC-3′ |
| R: 5′-TCACTGTACTCGCCGAAGGTCTC-3′ | |
| mmu-miR-214-3p | F: 5′-TACAGCAGGCACAGACAGGC-3′ |
6
RNA Extraction and Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from GBC tissue samples and cell lines using TRIzol (TaKaRa, China) according to the manufacturer's protocol. For mRNA and lncRNA analyses, the reverse transcription and qPCR reactions were performed as previously described [18 (link)]. ACTIN was used as an internal control. For miRNA analyses, RNA was reversed transcribed into cDNAs using the microRNA First Strand cDNA Synthesis kit (Sangon Biotech, China). The cDNA template was amplified by real-time RT-PCR using the microRNAs Quantitation PCR kit (Sangon Biotech, China). Expression of miRNA was normalized with respect to small nuclear RNA U6. The real-time PCRs were performed in triplicate. The relative mRNA expression change was calculated by using 2−△△Ct method. The PCR primers used were as follows: 5′-AAAGACCTGTACGCCAACAC-3′ (forward) and 5′-GTCATACTCCTGCTTGCTGAT-3′ (reverse) for ACTIN, 5′-TGGGAATGGAGGGAAATAAA-3′ (forward) and 5′-CCAGGAACTGTGCTGTGAAG-3′ (reverse) for LINC00152, and 5′-TGCAACATGGAAGGTATTGC-3′ (forward) and 5′-TTCACAAATCAGCACCAAGC-3′ (reverse) for HIF-1α.
7
Quantifying mRNA and miRNA Levels in Renal Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from mouse renal tissues, HEK293 cells, and NRK-52E cells was extracted using Trizol Reagent (Invitrogen) according to the manufacturer’s instructions. For miRNA, total RNA was reverse transcribed into cDNA using a microRNA First-Strand cDNA Synthesis Kit (Sangong Biotech, Shanghai, China). For mRNA, cDNA was obtained using the GoScript Reverse Transcription System Kit (Promega, Madison, WI, United States). GAPDH and small nuclear U6 were used as endogenous controls for mRNA and miRNA levels respectively. Gene expression levels were analyzed by Real-time PCR performed using 2 × SYBR master mix (Takara, Otsu, Shiga, Japan) and a BioRad iCycler iQ5 (BioRad, Hercules, CA, United States). GAPDH and U6 were used as the endogenous controls for measurement of mRNA expression level and miRNA expression analysis, relative mRNA expressions were compared with normalized Sham group. All samples were run in duplicate. Primer sequences are listed in Table 1 .
8
Quantification of GRIN2D mRNA and miR-129-1-3p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TransZol (Beijing TransGen Biotech). Each RNA sample was reverse transcribed into cDNA using the TransStart Top Green qPCR SuperMix kit (Beijing TransGen Biotech). The levels of GRIN2D mRNA and GAPDH mRNA were determined by qRT‐PCR. Total miRNA was isolated using the SanPrep Column MicroRNA Mini‐Preps Kit (Sangon Biological Engineering Technology & Services Co., Ltd). Each miRNA sample was reverse transcribed into cDNA using the MicroRNA First Strand cDNA Synthesis Kit (Sangon). The levels of miRNA‐129‐1‐3p and U6 snRNA were determined by qRT‐PCR using the MicroRNAs Quantitation PCR Kit (Sangon). The PCR primer sequences are shown in Tables 2 and 3 . Relative expression levels of GRIN2D and miRNA‐129‐1‐3p were calculated using the 2−ΔΔCt method and normalized to GAPDH and U6, respectively.
9
Quantification of miRNA-196a Isoforms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A549 cells and H1299 cells were planted on cell culture vessel before transfection of expression plasmid vectors, each vector was transfected into cells using Lipofectamine 3000 transfection reagent (Invitrogen, USA). We use the RNAiso Plus RNA isolation Kit (Takara, Japan) to isolate the total RNA from cells transfected with each of the vectors (empty vector, pre-miR-196a-C, and pre-miR-196a-T) 48 hours after transfection. Instantly, RNA samples were reverse transcribed to cDNA using the MicroRNA First Strand cDNA Synthesis Kit (Sangon, China) which can polyadenylate the miRNAs along with the cDNA synthesis.
10
Quantitative RT-PCR Analysis of Circular RNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by a RNAiso Plus kit (Takara, Dalian, China). cDNA was synthesized respectively by a PrimeScript RT Reagent Kit (Takara, Dalian, China) and a microRNA First-Strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China). qRT-PCR was conducted on an ABI PRISM® 7300 Sequence Detection System (Applied Biosystems, Carlsbad, CA, USA). The gene expressions were normalized by β-actin/U6 expression. All primer sequences were accordingly synthesized by RiboBio Co., Ltd. (Guangzhou, China), and the sequences of the primers are completely detailed in Table 1 .Table 1
Primer sequence.
| Gene | Sequence |
|---|---|
| circ_0000317 | F: 5’-GTGATCTGAAAGGGCCAGAG-3’ |
| R: 5’-TCCACATCACCCTTCACCTT-3’ | |
| PTEN | F: 5’-TAGAGCGTGCAGATAATGACAAGGA-3’ |
| R: 5’-TGAACTGCTAGCCTCTGGATTTGA-3’ | |
| β-actin | F: 5’-GGGAAATCGTGCGTGACATTAAG-3’ |
| R: 5’-TGTGTTGGCGTACAGGTCTTTG-3’ | |
| U6 | F: 5’-ATTGGAACGATACAGAGAAGATT-3’ |
| R: 5’-GGAACGCTTCACGAATTTG-3’ |
F, Forward; R, Reverse.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!