Fastpure total rna isolation kit

Manufactured by Vazyme

Sourced in China

The FastPure Total RNA Isolation Kit is a tool used for the extraction and purification of total RNA from various biological samples. It utilizes a spin column-based method to efficiently isolate high-quality RNA for downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions) Primescript rt reagent kit, by Takara Bio (2 mentions) Chemidoc touch imaging system, by Bio-Rad (1 mentions) Chemiluminescent nucleic acid detection module kit, by Thermo Fisher Scientific (1 mentions) Steponeplus pcr system, by Thermo Fisher Scientific (1 mentions) Anti α sma, by Abcam (1 mentions) Anti β tubulin, by ABclonal (1 mentions) Hiscript 3 all in one rt supermix, by Vazyme (1 mentions) Quantstudio 5, by Thermo Fisher Scientific (1 mentions) Ds 11 spectrophotometer, by DeNovix (1 mentions) Sybr green dye, by Takara Bio (1 mentions) Prism 9, by GraphPad (1 mentions) Lightcycler 480 2, by Roche (1 mentions) Lightcycler 480 2 real time pcr system, by Roche (1 mentions)

Spelling variants of this product

FastPure Cell/Tissue Total RNA Isolation Kit (188 citations) FastPure Cell/Tissue Total RNA Isolation Kit V2 (139 citations) RNA Isolation Kit (44 citations) FastPure Universal Plant Total RNA Isolation Kit (42 citations) FastPure Cell Total RNA Isolation Kit (9 citations) FastPure Tissue Total RNA Isolation Kit (6 citations) FastPure RNA isolation kit (4 citations) FastPure Plant Total RNA Isolation Kit (Polysaccharides & Polyphenolics-rich) (4 citations) FastPure® Plant Total RNA Isolation Kit (Polysaccharides (2 citations) FastPure Plant Total RNA Isolation Kit RC401 (2 citations)

8 protocols using fastpure total rna isolation kit

In Vitro Transcription and Northern Blot of Ribozymes

Check if the same lab product or an alternative is used in the 5 most similar protocols

For IVT RNAs, the expression unit in the pRAP expression
construct, from the T7 promoter to the terminator, was PCR amplified
and used as a template for IVT according to the standard protocol.
For in vivo RNAs, total RNAs were extracted from E.
coli cells with the FastPure Total RNA Isolation Kit
(Vazyme). The cells were transformed with the pRAP co-expression vector
and induced with IPTG for at least 2 h before being harvested for
RNA isolation. For Northern blotting, total RNAs (2 μg per lane)
or IVT RNAs (0.1 μg per lane) were subjected to 1.2% formaldehyde
agarose gel electrophoresis. The RNAs were then transferred to the
nylon membrane and cross-linked to the membrane using a UV transilluminator
(254 nm). The membrane with immobilized RNAs was then incubated in
a 20 mL hybridization buffer containing 0.25 pmol/mL biotin-labeled
DNA probes (5′-biotin-GCTATTTTTGCGGGCTTGTAACCGCCCTCGGC-3′)
that targets the twister ribozyme. The biotin-labeled probes were
detected using a Chemiluminescent Nucleic Acid Detection Module Kit
(Thermo Scientific, USA). The results were visualized using the ChemiDoc
Touch imaging system (Bio-Rad).

Liu Y., Wu Z., Wu D., Gao N, & Lin J. (2022). Reconstitution of Multi-Protein Complexes through Ribozyme-Assisted Polycistronic Co-Expression. ACS Synthetic Biology, 12(1), 136-143.

+ Open protocol

+ Expand

Quantifying ACRBP Expression in Ovarian Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from OC tissues, normal ovarian tissues, and OC cells by using a Fast Pure Total RNA Isolation Kit (Vazyme Biotech Co., Ltd.) following the manufacturer's protocol. cDNA was then synthesized using a Revert AidTM First‐Strand cDNA Synthesis Kit (MBI Fermentas). qRT‐PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems) following the manufacturer's instructions. Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) was used as an internal control. ACRBP mRNA level was analyzed via the 2‐ΔΔCt method and expressed as fold change compared with GAPDH. The primer sequences are as follows:
ACRBP: Forward, 5′‐CAGTGACAGAACGCCAGACCTTC‐3′,
Reverse, 5′‐CCTTGCTCCTGCTTGTGCTCTG‐3.
GAPDH: Forward, 5′‐GCACCGTCAAGGCTGAGAAC‐3′,
Reverse, 5′‐TGGTGAAGACGCCAGTGGA‐3′.

Lin L., Nong W., Luo B., Ge Y., Zeng X., Li F., Fan R., Zhang Q, & Xie X. (2021). Cancer‐testis antigen ACRBP expression and serum immunoreactivity in ovarian cancer: Its association with prognosis. Immunity, Inflammation and Disease, 9(4), 1759-1770.

+ Open protocol

+ Expand

Transcriptome Analysis via RT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Reverse-transcription PCR (RT-PCR) was conducted to assess the consistency between MATS results and their corresponding DAS events. Total RNA was extracted using FastPure total RNA isolation kit (RC411, Vazyme Biotech Co., Ltd. (Nanjing, China)) according to the manufacturer’s protocol. RT-PCR was performed using bulked RNA from exactly the same samples prepared for PacBio sequencing to maintain consistency. RNA was reverse transcribed using Takara (Takara Biomedical Technology, Beijing, China) PrimeScript RT reagent kit. The primers for each gene were designed by Primer Premier 6.0. Same PCR reactions were used for all thermal profiles: 95 °C for 5 min, followed by 35 cycles at 95 °C for 20 s, 55 °C for 30 s, 72 °C for 45 s, and then 72 °C for 5 min. PCR products were separated into a 1.5% agarose gel.

Liu J., Li D., Zhu P., Qiu S., Yao K., Zhuang Y., Chen C., Liu G., Wen M., Guo R., Yao W., Deng Y., Shen X, & Li T. (2023). The Landscapes of Gluten Regulatory Network in Elite Wheat Cultivars Contrasting in Gluten Strength. International Journal of Molecular Sciences, 24(11), 9447.

+ Open protocol

+ Expand

RNA Extraction and Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the FastPure total RNA isolation kit (Vazyme Biotech Co., Nanjing, China) and reverse-transcribed to complementary DNA using HiScript III All-in-one RT SuperMix (Vazyme Biotech Co, Nanjing, China), according to the manufacturer’s instructions. Real-time PCR was performed with SYBER Green PCR Master Mix (Vazyme Biotech Co, Nanjing, China) using a StepOnePlus PCR system (Applied Biosystems, Foster City, CA, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal normalizer. Primer sequences are noted in the Supplementary materials. Western blot was used to measure α-SMA expression levels in CFs. The primary antibodies were anti-α-SMA (Abcam, Cambridge, UK) and anti–β-tubulin (ABclonal, Wuhan, China).

Wang Y., Bai L., Wen J., Zhang F., Gu S., Wang F., Yin J, & Wang N. (2022). Cardiac-specific renalase overexpression alleviates CKD-induced pathological cardiac remodeling in mice. Frontiers in Cardiovascular Medicine, 9, 1061146.

+ Open protocol

+ Expand

Isolation and Transcriptional Analysis of Gastric Cancer TAMs and CD8+ T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

TAMs and tumour‐infiltrating CD8⁺ T cells were isolated from fresh gastric cancer tissues by human CD14 and CD8 nanobeads (MojoSort, BioLegend), respectively. Total RNA from TAMs, tumour‐infiltrating CD8⁺ T cells and AGS cell line was extracted by FastPure Total RNA Isolation Kit (Vazyme Biotech). RNA quantity and quality were determined with use of DS‐11 Spectrophotometer (DeNovix). RNA was transcribed into cDNA by PrimeScript RT reagent Kit (TaKaRa). Quantitative polymerase chain reaction (qPCR) was performed on QuantStudio5 (Applied Biosystems) with use of SYBR Green dye (TaKaRa). The primers used in this study were also listed (Table S4). At least three independent experiments were repeated for one sample. Relative transcript levels were estimated by means of ΔΔCt method.

Cao Y., Yu K., Zhang Z., Gu Y., Gu Y., Li W., Zhang W., Shen Z., Xu J, & Qin J. (2024). Blockade of V‐domain immunoglobulin suppressor of T‐cell activation reprograms tumour‐associated macrophages and improves efficacy of PD‐1 inhibitor in gastric cancer. Clinical and Translational Medicine, 14(2), e1578.

+ Open protocol

+ Expand

Comprehensive Transcriptomic Analysis of Litsea chinense

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We collected samples of shoot, leaf, bud, stigma, stamen, sepal, petal and six embryonic development stages (callus, globular embryo, heart-shaped embryo, torpedo embryo, early cotyledon embryo, cotyledon embryo) of L. chinense. Tissue samples were taken from the adult trees of L. chinense in Nanjing Forestry University (Nanjing, China). Total RNA extraction was performed using a FastPure Total RNA Isolation Kit from Vazyme (Nanjing, China) (RC401) corporation. In this study, we set three biological replicates for each group of samples, and three technical replicates for each biological replicate [70 (link)]. All primers for qRT-PCR were designed by Primer3.0 and are listed in Table S5. All experiments were run on 96-well plates. All data generated from qRT-PCR were calculated by the 2^−△△CT formula. ACT97 was selected as the internal reference gene, one-way analysis of variance was performed using IBM SPSS Statistics 26, and GraphPad Prism 9 was used to draw the histogram.

Xu L., Liu Y., Zhang J., Wu W., Hao Z., He S., Li Y., Shi J, & Chen J. (2024). Genomic survey and expression analysis of LcARFs reveal multiple functions to somatic embryogenesis in Liriodendron. BMC Plant Biology, 24, 94.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used the FastPure total RNA isolation kit (Vazyme, Nanjing, China, RC101) to extract total RNA. PrimeScriptTM RT kits were used to reverse-transcribed, and TB GreenTM Ex TaqTM kits were used to execute the qRT-PCR. RT-PCR was performed using a Light Cycler480 II instrument (Roche, Germany). lncRNAs and mRNAs were normalized using the expression of GAPDH, and the relative RNA levels were analyzed by2-ΔΔCT method. Gene-specific primer sequences of genes (Sparkjade, China) were designed and listed that in Table 1.

Zhou L., Han C., Liu Y., Cui T., Shen Z., Li X.Y., Jiang Y.H, & Li W. (2022). Astragalus membranaceus and Salvia miltiorrhiza Ameliorate Hypertensive Renal Damage through lncRNA-mRNA Coexpression Network. BioMed Research International, 2022, 3002353.

+ Open protocol

+ Expand

Quantifying PBK mRNA Expression in Ovarian Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from OC cell lines and tissues using a Fast Pure Total RNA Isolation Kit (Vazyme Biotech Co., Ltd, USA) following the manufacturer's instructions. cDNA was synthesized using a RevertAidTM First-Strand cDNA Synthesis Kit (MBI Fermentas, Canada). qRT-PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's protocol on a LightCycler480II Real-Time PCR System (Roche, Switzerland). GAPDH was used as an endogenous control. Relative mRNA level of PBK was analyzed by comparison CT (2 -ΔΔct ) method and expressed as fold change compared with GAPDH. The primer sequences are as follows： PBK: Forward 5'-TTACTTTGTGGGAAATGATGACTTTAT-3', Reverse 5'-CATTAGTGCATACAGAGAAGAGTTCAA-3'.
GAPDH: Forward 5'-GCACCGTCAAGGCTGAGAAC-3', Reverse 5'-TGGTGAAGACGCCAGTGGA-3'.

Lin L., Ge Y., Nong W., Zeng X., Liu C., Wu S., Wei X., Luo B., Zhang Q., & Xie X. (2022). PBK is a potential therapeutic target and prognostic biomarker in ovarian cancer: integrating bioinformatics and clinical analysis.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!