Epitect bisulphite kit

Bisulphite conversion of genomic DNA was carried out using the EpiTect Bisulphite Kit (Qiagen, Doncaster, VIC, Australia). Nested PCRs were performed to interrogate methylation at the Smad3-6 intergenic region with the following primers: Smad3-6 bis F1: AAGTGGAATTTTTTAGTGGTAGATG; Smad3-6 bis R1: AACTACTTTAATAAAAAATAACATAACC, Smad3-6 bis F2: TTGGTATGTGTTGTTTTTAGTTTTG and Smad3-6 bis R2: ACAATTTAACTATTCATTATATCTCTAACA. Cycling conditions were as follows: Primary PCR, 94°C for 2 minutes for 1 cycle; 94°C for 30 secs, 53°C for 30 secs, 72°C for 45 secs for 35 cycles and 72°C for 6 mins for 1 cycle. The secondary PCR was performed using an annealing temperature of 51°C. The PCR product was ligated into pGEM T Easy (Promega, Annandale, Australia) and transformed. DNA from individual colonies was sequenced using Sanger sequencing. The bisulphite conversion rate was ≥98% and sequences were analysed using BiQ Analyser software [38 (link)].

We extracted DNA samples from peripheral blood using Qiagen EZ1 Blood kit. We analyzed the DNA methylation levels of eight genes (TIMP-2, AKR1B1, MYL9, MMP-2, MMP-9, SCL2A1, SCL2A4 and SCL4A3) as a case control study (48 T2D patients with DN and 48 T2D patients without DN) with standard protocol of bisulfite and pyrosequencing. First of all, DNA was treated with sodium bisulfite using EpiTect bisulphite kit (Qiagen) and clean-up of bisulfite-converted DNA was made. PCR amplification was achieved using PyroMark CpG assay (Qiagen ID: 6508,6517,6513,10398,4318,7077,231) and PyroMark Gold Q24 Reagents kits (Qiagen) in a PyroMark Q24 system (BiotageAb, Uppsala, Sweden). PyroMark PCR master mix includes Hotstar Taq DNA polymerase and optimized PyroMark reaction buffer containing 3nMCl2 and dNTPs 10X CoralLoad Concentrate, 5x Q-Solution, 25 nM MgCl₂ and RNase free water. DNA methylation levels of the eight genes CpG island sites were discovered by using PyroMark Gold 24 reagent kit (Qiagen) and a PyroMark Q24 ID Pyrosequencing system (Biotage, Uppsala, Sweden). The unmethylated and unconverted DNA samples (Qiagen) were used for control of conversion efficiency in bisulfite treatment and accuracy in methylation analyzes. PyroQ-CpG software (Biotage) was used for methylation data analysis.

Genomic DNA was isolated and treated with sodium bisulphite using the EpiTect Bisulphite Kit (QIAGEN AB, Sollentuna, Sweden) according to the manufacturer's instructions. The bisulphite-converted DNA was amplified by PCR, using the following primers: 5′-TGGGTTAGAGTATAGTTAGGTTAGG-3′ (sense) and: 5′-AATCAAAACCCTCCACATACCTACA-3′ (antisense). The amplification product was electrophoresed on 1.5% agarose gels to confirm the correct product size of 416 base pairs. The product was then extracted from the gel using a QIAquick gel extraction kit (QIAGEN AB, Sollentuna, Sweden), and cloned into a pCR-II vector with the TA Cloning Kit Dual Promoter (Invitrogen/Life Technologies Corp., Foster City, CA, USA) according to the manufacturer's instructions. Ten colonies per cell line were picked for isolation of plasmid DNA, which was then sequenced (Eurofins, Uppsala, Sweden).