Genescreen plus membrane

For telomere length assay^{39 (link)}, genomic DNA was isolated using genomic DNA purification kit (Promega) and digested with AluI and MboI. Equal amounts of digested DNA (~4 μg) were separated by 0.7% agarose gel electrophoresis in 1× TBE, denatured, and transferred to a GeneScreen Plus membrane (PerkinElmer). The blot was crosslinked, hybridized at 42 °C with 5′-end-labeled ³²P-(TTAGGG)₄ probe in Church buffer, and washed twice for 5 min each with 0.2 M wash buffer (0.2 M Na₂HPO4 pH 7.2, 1 mM EDTA, and 2% SDS) at room temperature and once for 10 min with 0.1 M wash buffer at 42 °C. The images were analyzed by Phosphor-imager, visualized by Typhoon 9410 Imager (GE Healthcare), and processed with ImageQuant 5.2 software (Molecular Dynamics).

Total RNA was extracted from cell lines by the proteinase K method41 . For Northern analysis, RNA was fractionated on formaldehyde-agarose gels and transferred to GeneScreen Plus membrane (PerkinElmer Life Sciences), as previously described42 (link). Probe for β-actin was prepared by the random primer technique using DNA fragments isolated from plasmids containing PCR amplified cDNA sequences. Primers for amplification were designed according to sequences present in the NCBI Data Bank. For rRNA probes, an oligonucleotide (GTGAGCACGACGTCACCACATCGATCGAAGATC) complementary to human rRNA sequence (NR_046235) from position 431 (5′ETS) and an oligonucleotide (CCTCGCCCTCCGGGCTCCGTTAATTGATC) complementary to human rRNA sequence (NR_046235) from position 5520 (ITS1), were radiolabeled with [γ−³²P]-ATP41 . Quantitation of Northern blot filters was performed with a PhosphorImager (GE Healthcare).
For RNA analysis of DBA patients and controls, a written informed consent was signed by patients and controls or their parents or tutors. Blood was collected into PAXgene Blood RNA Tubes (PreAnalytiX) and RNA was purified using the PAXgene Blood RNA kit (PreAnalytiX) following manufacturer’s instructions.

Total RNA was extracted from cultured cells using TRIzoL^TM (Invitrogen). Samples (2 μg) were electrophoresed through 15% denaturing polyacrylamide gels. Separated RNA was electroblotted onto a GeneScreen Plus membrane (PerkinElmer, Beaconsfield, UK) and fixed by UV crosslinking prior to hybridization with radiolabelled probes. Probes for mt-tRNA^Phe, mt-tRNA^Val and mt-tRNA^Leu were produced by PCR amplification using the following primers (GenBank accession number for human mtDNA: NC_019290.1): human mt-tRNA^Leu(UUR) forward (position 3200–3219) 5′-TATACCCACACCCACCCAAG-3′ and reverse (position 3353–3334) 5′-GCGATTAGAATGGGTACAAT-3′; human mt-tRNA^Phe forward (position 552–570) 5′-CCAAACCCCAAAGACACCC-3′ and reverse (position 712–694) 5′-GAACGGGGATGCTTGCATG-3′; human mt-tRNA^Val forward (position 1579–1598) 5′-CTGGAAAGTGCACTTGGACG-3′ and reverse (position 1734–1714) 5′-GGGTAAATGGTTTGGCTAAGG-3′. Purified PCR products were labelled with [α-³²P] dCTP (250 μCi, 3000 Ci/mmol; Perkin Elmer) using random hexamers and free nucleotides were removed by gel filtration. Hybridization was carried out overnight at 42 °C in 5 × SSPE, 1% SDS, 10% (w:v) dextran sulphate, 50% (v:v) formamide and 5 × Denhardt's solution. Membranes were stringently washed before detection of signal by PhosphorImager/ImageQuant software.

hsa-miR-1-1, miR-17∼92, NMSL-A/U and NMSLR-A/U constructs were inserted (KpnI and XhoI sites) into pcDNA 3.1 (+). HEK293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM) media supplemented with 10% fetal bovine serum (FBS). Cells were transfected with 30 μg of total DNA (5 μg of miR-1-1 vector plus 25 μg of cluster vector) using the calcium phosphate method (20 (link)). Total RNA was prepared with 1 ml of Trizol (Invitrogen). Twenty micrograms of total RNA was resolved by 15% (19:1) denaturing PAGE and electrotransferred to GeneScreen Plus membrane (Perkin Elmer). Blots were probed at 42°C with 5′-[³²P]-end-labeled DNA oligonucleotides [in UltraHyb Oligo buffer (Ambion)] complementary to the mature miRNA sequences. The human miR-1-1 pri-miRNA insert was generated by PCR: forward primer 5′-ATA CCG CTC GAG CTT CTG CCT TTC TGG ATC GTG T-3′; reverse primer 5′-ATA CCG CTC GAG CTG CTG ACA CAG GAA AGT GAC-3′ and was cloned into the XhoI site of pcDNA 3.1 (+). miRNA expression was quantified with ImageQuant (5.2) software. The sum of the amount of pre-miRNA and mature miRNA [corrected for lane loading (U6 probing) and transfection efficiency (miR-1-1 probing) and background endogenous expression] for each miRNA from each mutant cluster, was normalized to wild-type expression. Bar graphs were generated with Excel software.

K562C, TF-1C and PC3 cells (1–2 × 10⁶) were washed once with PBS buffer (150 mM NaCl, 2.7 mM KCl, 8 mM NaH₂PO₄ and 1.4 mM K₂PO₄), lysed with 300 μl of lysis buffer (10 mM NaCl, 10 mM MgCl₂, 10 mM Tris-HCl pH 7.5, 1% triton-X100, 1% sodium deoxycholate, 36 U/ml RNase inhibitor (Promega), 1 mM dithiothreitol) and transferred into a microcentrifuge tube. After 2 min of centrifugation at 16 000 g at 4°C, the supernatant was frozen in liquid nitrogen and stored at −70°C to be analyzed later, or immediately layered onto a 15–50% (w/v) sucrose gradient (containing 30 mM Tris-HCl pH 7.5, 100 mM NaCl and 10 mM MgCl₂) and centrifuged in a Beckman SW41 rotor for 110 min at 170 000 g. Fractions were collected while monitoring the optical density at 254 nm. RNA was extracted from each polysomal fraction, from cells and from the only cytoplasmic compartment by the proteinase K method. For northern analysis, RNA was fractionated on formaldehyde-agarose gels and transferred to GeneScreen Plus membrane (PerkinElmer Life Sciences). Northern blotting was performed essentially as recommended by the manufacturer. Radioactive probes were prepared by the random primer technique using DNA fragments isolated from plasmids containing PCR-amplified cDNA sequences. Quantitation of northern blot filters was done with a PhosphorImager (GE Healthcare).

Total RNA was extracted from cultured cells with an miRNeasy Kit (Qiagen) according to the manufacturer's instructions. Samples of 20 μg of total RNA were resolved using a 15% polyacrylamide–1× Tris-borate–EDTA–8 M urea gel and blotted to a GeneScreen Plus membrane (Perkin-Elmer). The probe sequences of DNA oligonucleotides with sequences complementary to candidate miRNAs are as follows: miR-155 probe, 5′-CCCCTATCACGATTAGCATTAA-3′; E (XSR) miRNA probe, 5′-CAGAGGCAACTTGAATAGTCTA-3′; and MHV68-M1-7 probe, 5′-AATAAAGGTGGGCGCGATATC-3′. The 5.8S probe sequence is 5′-TTCTTCATCGACGCACGAGC-3′. The probes were end labeled with [γ-³²P]ATP (Amersham) and T4 polynucleotide kinase (New England BioLabs) to generate high-specific-activity probes. Hybridization, washing, and autoradiography were carried out as previously described (31 (link)).