Taq dna polymerase 2 master mix red

To detect mutations involving single base changes in immune-related genes, ARMS-PCR and restriction enzyme (RE) digestion were used. ARMS-PCR is based on using sequence-specific PCR primers to amplify target DNA that the nucleotide sequences contained in the sample. Following ARMS, the presence or absence of PCR products amplified from genomic DNA indicate single nucleotide variations (Figure 1). In parallel, some PCR products were digested by RE after clean up (RE listed in Table 1). Taq DNA Polymerase 2× Master Mix Red (Ampliqon, Odense M, Denmark) was used with the following PCR conditions: a pre-incubation for 15 min at 95 °C, 30 denaturation cycles at 95 °C for 30 s, annealing at 47–59 °C (temperatures listed in Table 1) for 40 s, extension at 72 °C for 30 s, and a final extension temperature of 60 °C for 5 min. The RE digested PCR product was separated into different fragments by using 2% agarose gel electrophoresis to distinguish single-nucleotide variation.

The total yeast DNA was extracted from the colonies grown on MYGP agar plates using the InstaGene Matrix DNA extraction kit (Bio-Rad Laboratories, Hercules, CA, USA). Rep-PCR was conducted in a 25 μL volume mixture containing 13 μL of Taq DNA Polymerase 2× Master Mix RED (Ampliqon, Odense, Denmark), 5 μL Primer GTG₅ (Integrated DNA Technologies, Denmark), 4 μL sterile Milli-Q water, and 3 μL DNA. The PCR reaction was carried out in a SureCycler 8800 thermocycler (Agilent Technologies, Santa Clara, CA, USA) using the following program: initial denaturation for 7 min at 95 °C, followed by 30 cycles of 95 °C for 1 min, 45 °C for 1 min, and 65 °C for 8 min, and an elongation step of 65 °C for 16 min. The rep-PCR products were separated by 1.5% agarose gel electrophoresis (5 h, 120 V) in Tris-Borate-EDTA buffer (0.5 × TBE), using an O’GeneRuler 1 kb DNA ladder (Thermo Scientific, Roskilde, Denmark) as a reference marker. The rep-PCR profiles were clustered using Bionumerics 7.1 software (Applied Maths, BioMérieux, Schaerbeek, Belgium) based on Dice’s Coefficient of similarity with the Unweighted Pair Group Method and Arithmetic mean clustering algorithm (UPGMA).

A total of 71 paratypes were subjected for molecular characterizations. Before DNA isolation, adult flies were separately washed thoroughly with 70% ethanol and centrifugation. Total genomic DNA was extracted from the whole body of each fly, using the GeneAll Exgene^TM Cell SV Mini Kit (Seoul, Korea) and according to the protocol for animal tissues. DNA concentration was evaluated by measuring the absorbance at 260 nm using a PowerWave XS Microplate Spectrophotometer (BioTek, Vermont, USA). DNA specimens were stored at -20°C until investigation.
Portions of three different loci, including one mitochondrial cytochrome oxidase I (COI; 831 bp) and two nuclear expansion segment D7 of 28S rRNA (28S; 607 bp) and Arginine kinase (AK; 756 bp) genes, were amplified and sequenced using the oligonucleotide primers and thermal profiles specified in Table 1. All PCR amplifications were performed in a 25 μL volume using the Taq DNA Polymerase 2× Master Mix RED from Ampliqon (Denmark), with the subsequent mixtures: 1–2 μL of DNA extract (~0.1 μg), 12.5 μL of Master mix, 1 μL of each primer (10 mM), and 8.5–9.5 μL of sterile water. PCR products were checked via 1.5% agarose gel electrophoresis, followed by GreenViewer staining and photographing using a UV transilluminator. Fruitful amplicons were purified and sequenced at both directions by Genomin Company, Tehran, Iran.

Buccal cells were harvested from the inner cheek of each subject to provide DNA for genetic testing. The DNA was extracted from buccal swabs using a QIAamp DNA Mini Kit. The procedure employed a polymerase chain reaction (PCR)–based protocol followed by restriction endonuclease digestion to identify the 5-HTTLPR that are located in the promoter region of the serotonin transporter gene (SLC6A4) and rs25531 variants: S, LA, and LG. Forward primer: 5′-TCCTCCGCTTTGGCGCCTCTTCC-3′ and reverse primer: 5′-TGGGGGTTGCAGGGGAGATCCT-3′ (10 μM each) were used for 50 μL PCR containing approximately 25 ng DNA, 25 μL Taq DNA Polymerase 2× Master Mix Red (Ampliqon) and ddH2O, with an initial 5-min denaturation step at 95°C followed by 35 PCR cycles of 95°C (30 s), 65°C (40 s), and 72°C (30 s) and a final extension step of 5 min at 72°C. To distinguish the A/G single-nucleotide polymorphism of the rs25531, we extracted 10 μL of the PCR product for digestion by FastDigest HpaII (Thermo, FD0514), an isoschizomer of MspI, a total reaction of 20 μL. These were loaded side by side on 2.5–3.0% agarose gel.

A PCR reaction was performed to check the quality of purified DNA and to determine whether any inhibitory material was interfering with the reaction. For this purpose, exon 3 of the crystalline gamma‐D (CRYGD) gene with a fragment of 636 base pairs was amplified in a 10 μL reaction, 3 μL Taq DNA Polymerase 2× Master Mix Red (Ampliqon), one microliter of extracting DNA, and 0.5 pmol forward primer (5′‐TGAATCTCTGTGGGTAATG‐3′) and 0.5 pmol reverse primer (5′ CGTCATTCTGTTGTGAGAACTTCC 3′). The amplification conditions for PCR were as follows: 95°C for 7 minutes to denature the template, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at 52°C for 20 seconds, DNA extension at 72°C for 30 seconds, and the final extension at 72°C for 10 minutes. The amplification cycles were performed by PCR system GeneAtlas 322/325 (ASTEC, Seoul, Korea). The amplified DNA was identified by 1.5% agarose gel electrophoresis with DNA Green Viewer™ (Pars tous, Iran) staining and visualized by UV light. Sequencing was performed to confirm the validity of size (639 bp) with gel electrophoresis (Kawsar, Iran).

The multiplex PCR method and conditions used to identify phylogroups A, B1, B2, C, D, E, F, and cryptic clade I were previously described [9 (link)]. This method allows for the identification of different phylogroups by amplifying chuA and yjaA, the DNA fragments TspE4.C2, and arpA. The final multiplex PCR reaction volume was 20 μL, which included 9 μL of Taq DNA Polymerase 2× Master Mix RED (Ampliqon), 1 μL of first forward and reverse primers, and 3 μL of DNA template (300 ng). The concentration of the primers used was 10 pmol. To determine groups E and C, singleplex PCR was performed separately. The PCR conditions were as follows: 4 min at 94 °C, 30 cycles of 5 s at 94 °C, and 20 s at 57 °C (group E) or 59 °C (group C), and a final extension of 5 min at 72 °C [9 (link)].