RNA was isolated using TRIzol reagent (Invitrogen) following the manufacturer’s protocol. All procedures were carried out using RNase-free reagents and consumables. One microgram of RNA was reverse transcribed into cDNA using Moloney-murine leukemia virus (M-MLV) reverse transcriptase and random primers (Promega, Madison, WI, USA) in 20 μL reaction volume. Quantitative PCR (qPCR) assays were carried out using a Mastercycler ep realplex S (Eppendorf, Sydney, Australia) and the fluorescent dye SYBR Green (Bio-Rad, 1725270, Sydney, Australia), following the manufacturer’s protocol. Briefly, each reaction (20 μL) contained 1× mastermix, 5 pmoles of primers and 1 μL of cDNA template. Amplification was carried out with 40 cycles of 94 °C for 15 s and 60 °C for 1 min. Gene expression was normalized to the housekeeper gene β-actin. A no-template control was included for each PCR amplification assay. The level of expression for each gene was calculated using the comparative threshold cycle (Ct) value method using the formula 2−ΔΔCt (where ΔΔCt = ΔCt sample−ΔCt reference). PCR products were visualized using 1% agarose gel electrophoresis.
Mastercycler ep realplex s
Manufactured by Eppendorf
Sourced in Australia, Germany
The Mastercycler ep realplex S is a real-time PCR system designed for quantitative gene expression analysis. It features a thermal block that can accommodate a variety of sample formats, including 96-well plates and tube strips. The system is equipped with a high-resolution optical detection system for precise fluorescence measurement during the amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green, by Bio-Rad (9 mentions)
M mlv reverse transcriptase and random primers, by Promega (6 mentions)
Trizol reagent, by Thermo Fisher Scientific (6 mentions)
Tri reagent, by Merck Group (3 mentions)
6 well plate, by BD (2 mentions)
Qiaamp dna mini kit, by Qiagen (2 mentions)
Moloney murine leukemia virus reverse transcriptase and random primers, by Promega (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Random primer, by Promega (1 mentions)
Moloney murine leukemia virus reverse transcriptase, by Promega (1 mentions)
Masterclear cap strips, by Eppendorf (1 mentions)
Taqman environmental master mix, by Thermo Fisher Scientific (1 mentions)
Genorm kit, by Primerdesign (1 mentions)
Rna 6000 nano labchip kit, by Agilent Technologies (1 mentions)
Qiazol lysis reagent, by Qiagen (1 mentions)
Sybr primescript rt pcr kit 2, by Takara Bio (1 mentions)
Primer premier 5, by Premier Biosoft (1 mentions)
Sybr green, by Takara Bio (1 mentions)
Rneasy spin column, by Qiagen (1 mentions)
Ab high capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
15 protocols using mastercycler ep realplex s
1
RNA Isolation and qPCR Analysis
2
Quantifying Lentiviral Transduction Efficiency
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 3
qPCR reactions: HEK 293T cells are seeded in 6-well plates (BD Falcon) in culture medium and incubated for 4 h at 37° C., 5% CO2 in moist atmosphere. Cells are transduced with 3 successive dilutions of lentiviral vector. 72 h post-incubation, cells are harvested and transduced HEK 293T cell pellets are produced. Total genomic DNA from transduced cell-pellets is extracted using a method based on QIAGEN QIAamp DNA mini kit handbook. Proviral quantification is performed using Taqman qPCR. The amplification is performed with the Master Mix (Fermentas Thermo Scientific), the Flap A (CCCAAGAACCCAAGGAACA; SEQ ID NO:26) and Flap S (AGACAA GATAGAGGAAGAGCAAAAC; SEQ ID NO:27) primers and LENTI TM probe (6FAM-AACCATTAGGAGTAGCACCCACCAAGG-BBQ; SEQ ID NO:52). Normalization is performed with the quantification of the actin gene (same Mix, Actine A-CGGTGAGGATCTTCATGAGGTAGT-(SEQ ID NO:28), Actine S-AACACCCCAGCCATGTACGT-(SEQ ID NO:29) primers and HUMURA ACT TM probe-6FAM-CCAGCCAGGTCCAGACGCAGGA-BBQ-(SEQ ID NO:30). Both reactions are achieved on MasterCycler Ep Realplex S (Eppendorf, 2 min at 50° C., 10 min at 95° C. and 40 cycles of 15 seconds at 95° C. and 1 min at 63° C.). The analysis is performed on MasterCycler Ep Realplex Software.
3
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using TRI Reagent (Sigma, Castle Hill, NSW, Australia) following the manufacturers protocol. All procedures were carried out using RNase-free reagents and consumables. Two micrograms of RNA were reverse transcribed into cDNA using Moloney-murine leukemia virus reverse transcriptase and random primers (Promega, Annandale, NSW, Australia) in a 20 μl reaction mixture. cDNA was then used as a template in quantitative PCR, using a Mastercycler ep realplex S (Eppendorf) and the fluorescent dye SYBR Green (Bio-Rad), following the manufacturer’s protocol. Briefly, each reaction (20 μl) contained 1x RealMasterMix, 1x SYBR Green, 5 pmoles of primers and 1 μl of template. Amplification was carried out with 40 cycles of 94°C for 15 s and 60°C for 1 min. Gene expression was normalized to the housekeeper genes β-actin, GAPDH and cyclophilin A. All primers used are listed in Table 2 . A no-template control was included for each PCR amplification assay. The level of expression for each gene was calculated using the comparative threshold cycle (Ct) value method using the formula 2-ΔΔCt (where ΔΔCt = ΔCt sample – ΔCt reference).
4
RNA Isolation and qPCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using TRIzol reagent (Invitrogen) following the manufacturer’s protocol as previously described1 (link). All procedures were carried out using RNase-free reagents and consumables. One microgram of RNA was reverse transcribed into cDNA using Moloney-murine leukemia virus (M-MLV) reverse transcriptase and random primers (Promega, Madison, Wisconsin, USA) in 20 μl reaction volume. Quantitative PCR (qPCR) assays were carried out using a Mastercycler ep realplex S (Eppendorf, Sydney, Australia) and the fluorescent dye SYBR Green (Bio-Rad), following the manufacturer’s protocol. Briefly, each reaction (20 μl) contained 1 × mastermix, 5 pmol of primers and 1 μl of cDNA template. Amplification was carried out with 40 cycles of 94 °C for 15 s and 60 °C for 1 min. Gene expression was normalized to the geometric mean of three housekeeper genes, GAPDH, β-actin and PPIA. A no-template control was included for each PCR amplification assay. The level of expression for each gene was calculated using the comparative threshold cycle (Ct) value method using the formula 2−ΔΔCt (where ΔΔCt = ΔCt sample—ΔCt reference).
5
Inclusivity/Exclusivity qPCR Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
qPCR reactions were performed for all DNA extracts of the inclusivity/exclusivity panel for the established assay (Table 1 ) and run on a Mastercycler® ep realplex S (Eppendorf, Hamburg, Germany). Each qPCR reaction was performed in a total volume of 25 μL, containing 5 μL template DNA, 8.7 μL sterile ddH2O, 1.3 μL primer-probe-mix (primers: 18 μM and probe: 5 μM in the stock), and 10 μL TaqMan Environmental Master Mix (Applied Biosystems, Foster City, California) avoiding PCR inhibition [27 (link)]. Eppendorf real-time PCR tube strips covered with Masterclear® cap strips (Eppendorf, Hamburg, Germany) were used as reaction vessels for amplification and detection. The qPCR temperature profile entailed the following steps: initial denaturation (2 min at 50°C) for optimal Uracil-N-Glycosylase enzyme activity and successive activation of the DNA polymerase (10 min at 95°C), followed by 50 cycles of 15 sec at 95°C and 1 min at 60°C. Two negative controls (environmental control and extraction blank control) were included at least once in qPCR procedures to exclude any contamination.
6
Quantitative PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using TRIzol reagent (Invitrogen) following the manufacturer’s protocol. All procedures were carried out using RNase-free reagents and consumables. One microgram of RNA was reverse transcribed into cDNA using Moloney-murine leukemia virus (M-MLV) reverse transcriptase and random primers (Promega, Madison, Wisconsin, USA) in 20μl reaction volume. Quantitative PCR (qPCR) assays were carried out using a Mastercycler ep realplex S (Eppendorf, Sydney, Australia) and the fluorescent dye SYBR Green (Bio-Rad), following the manufacturer’s protocol. Briefly, each reaction (20μl) contained 1x mastermix, 5 pmoles of primers and 1μl of cDNA template. Amplification was carried out with 40 cycles of 94°C for 15 s and 60°C for 1 min. Gene expression was normalized to the housekeeper gene GAPDH. A no-template control was included for each PCR amplification assay. The level of expression for each gene was calculated using the comparative threshold cycle (Ct) value method using the formula 2–ΔΔCt (where ΔΔCt =ΔCt sample –ΔCtreference).
7
Quantitative Analysis of α-Synuclein Expression in Parkinson's Disease
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using TRI Reagent (Sigma, Castle Hill, NSW, Australia) following the manufacturer’s protocol from control (n = 10) and MSA (n = 8) tissues. All procedures were carried out using RNase-free reagents and consumables. Five micrograms of RNA was reverse transcribed into cDNA using Moloney-murine leukemia virus reverse transcriptase and random primers (Promega, Annandale, NSW, Australia) in a 20 μl reaction volume. cDNA was used as a template in the quantitative real-time PCR (qPCR) assay, which was carried out using a Mastercycler ep realplex S (Eppendorf) and the fluorescent dye SYBR Green (Bio-Rad), following the manufacturer’s protocol. Briefly, each reaction (20 μl) contained 1x RealMasterMix, 1x SYBR Green, 5 pmoles of primers and 1 μl of template. Amplification was carried out with 40 cycles of 94°C for 15 sec and 60°C for 1 min. Gene expression was normalized to the housekeeper gene β-actin. The primers used were: α-synuclein F:TAGGCTCCAAAACCAAGGAGG R:CCTTCTTCATTCTTGCCCAACT; β-actin F:TCATGAAGTGTGACGTGGACATCCGT R:CCTAGAAGCATTTGCGGTGCACGATG.
The level of expression was calculated using the comparative threshold cycle (Ct) value method using the formula 2−∆∆Ct (where ∆∆Ct = ∆Ct sample – ∆Ct reference).
The level of expression was calculated using the comparative threshold cycle (Ct) value method using the formula 2−∆∆Ct (where ∆∆Ct = ∆Ct sample – ∆Ct reference).
8
Quantification of GALNT14 Expression in Neuroblastoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 15 NB cell lines and 76 NB samples using QIAzol Lysis Reagent (Qiagen) according to the manufacturer's instructions, and reverse transcription performed with iScript Reverse Transcription Supemix kit (Biorad). RNA quality was checked by 2100 BioAnalyzer using RNA 6000 Nano LabChip kit (Agilent Technologies) and quantified by NanoDrop (Thermo Scientific). Only RNAs with a RIN > 7 were included in subsequent experiments. The geNORM kit (Primerdesign) was employed to select the most stable housekeeping genes in our experimental set of samples that resulted to be 18S-RNA and GAPDH in NB cell lines and 18S-RNA, GAPDH and UBC in NB patients. RT-qPCR was carried out on the Mastercycler ep Realplex S (Eppendorf) using TaqMan FAM-labeled probes for GALNT14 (Assay ID: Hs00226180_m1, Life Technologies) and for 18S-RNA, GAPDH and UBC (Primerdesign).
9
Quantifying Lentiviral Transduction in HEK 293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 3
qPCR reactions: HEK 293T cells are seeded in 6-well plates (BD Falcon) in culture medium and incubated for 4 h at 37° C., 5% CO2 in moist atmosphere. Cells are transduced with 3 successive dilutions of lentiviral vector. 72 h post-incubation, cells are harvested and transduced HEK 293T cell pellets are produced. Total genomic DNA from transduced cell-pellets is extracted using a method based on QIAGEN QIAamp DNA mini kit handbook. Proviral quantification is performed using Taqman qPCR. The amplification is performed with the Master Mix (Fermentas Thermo Scientific), the Flap A (CCCAAGAACCCAAGGAACA; SEQ ID NO: 18) and Flap S (AGACAA GATAGAGGAAGAGCAAAAC; SEQ ID NO: 19) primers and LENTI TM probe (6FAM-AACCATTAGGAGTAGCACCCACCAAGG-BBQ; SEQ ID NO: 20). Normalization is performed with the quantification of the actin gene (same Mix, Actine A-CGGTGAGGATCTTCATGAGGTAGT- (SEQ ID NO: 21), Actine S-AACACCCCAGCCATGTACGT- (SEQ ID NO: 22) primers and HUMURA ACT TM probe-6FAM-CCAGCCAGGTCCAGACGCAGGA-BBQ- (SEQ ID NO: 23). Both reactions are achieved on MasterCycler Ep Realplex S (Eppendorf, 2 min at 50° C., 10 min at 95° C. and 40 cycles of 15 seconds at 95° C. and 1 min at 63° C.). The analysis is performed on MasterCycler Ep Realplex Software.
FACS analyses are then performed.
10
Quantitative PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using TRIzol reagent (Invitrogen) following the manufacturer’s protocol as previously described [36 (link)]. All procedures were carried out using RNase-free reagents and consumables. One microgram of RNA was reverse transcribed into cDNA using Moloney-murine leukemia virus (M-MLV) reverse transcriptase and random primers (Promega, Madison, Wisconsin, USA) in 20 μl reaction volume. Quantitative PCR (qPCR) assays were carried out using a Mastercycler ep realplex S (Eppendorf, Sydney, Australia) and the fluorescent dye SYBR Green (Bio-Rad), following the manufacturer’s protocol. Briefly, each reaction (20 μl) contained 1 × mastermix, 5 pmol of primers and 1 μl of cDNA template. Amplification was carried out with 40 cycles of 94 °C for 15 s and 60 °C for 1 min. Gene expression was normalized to the geometric mean of three housekeeper genes, GAPDH, β-actin and PPIA. A no-template control was included for each PCR amplification assay. The level of expression for each gene was calculated using the comparative threshold cycle (Ct) value method using the formula 2−ΔΔCt (where ΔΔCt = ΔCt sample – ΔCt reference).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!