The largest database of trusted experimental protocols

6 protocols using pr 619

1

Immunoprecipitation of AhR Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed with RIPA lysis buffer containing 3 deubiquitylase inhibitors — 1,10-phenanthroline (P0221, Tokyo Chemistry Industry), N-ethylmaleimide (E0136, Tokyo Chemistry Industry), and PR-619 (HY-13814, MedChemExpress) — for the immunoprecipitation experiments and the analysis of ubiquitylated proteins by anti-multiubiquitin antibody. One to two milligrams of whole-cell lysates were used for immunoprecipitation and coimmunoprecipitation of AhR using the anti-AhR antibody. Briefly, the anti-AhR antibody in (NH4)2SO4 was coupled to the pre-equilibrated Protein G Dynabeads in NaH2PO4 at 37°C overnight, following the manufacturer’s instructions. The AhR-coupled beads were then added to each sample and incubated on an orbital shaker at 0.5 g overnight at 4°C. After washing 3 times for 5 minutes each with the assay buffer, the beads were eluted with electrophoresis sample buffer for SDS-PAGE, followed by Western blot analysis.
+ Open protocol
+ Expand
2

Preparation of UP-nanovaccine from Cell Lysate

Check if the same lab product or an alternative is used in the 5 most similar protocols
Vx3 protein was obtained and covalently linked to α-Al2O3 nanoparticles to generate α-Al2O3-Vx3 nanoparticles according to our previous reports (12 (link), 13 (link)). 4T1/WT cells and 4T1/EPB cells were treated with 200 nM bortezomib (Millennium Pharmaceuticals, USA) and 20 mM NH4Cl (Sigma, USA) for 9 h. The cells were collected and lysed in RIPA lysis buffer (Millipore, USA) containing protease inhibitors (MedChemExpress, USA), phosphatase inhibitors (MedChemExpress, USA), and PR-619 (MedChemExpress, USA). The cell lysate was reacted with α-Al2O3-Vx3 nanoparticles under stirring for 12 h at 4°C to generate α-Al2O3-UPs nanovaccine (named UP-nanovaccine) according to our previous study (13 (link), 20 (link)). The precipitates (UP-nanovaccine) were collected by centrifugation (12,000 g, 30 min, 4°C), and the supernatant was collected as unbound lysate, followed by the detection of ubiquitin protein levels in the three samples using Western blotting. The covalently linked product UP-nanovaccine was collected by centrifugation, and the number of UPs enriched by α-Al2O3-Vx3 was evaluated by collecting and calculating the difference between the number of UPs in the supernatant before and after the reaction by BCA Protein Assay Kit (Beyotime Biotechnology, China) according to the protocol of the manufacturer.
+ Open protocol
+ Expand
3

Delineating Apoptotic Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
PR-619 was obtained from MedChemExpress (Junction, NJ, USA) and cisplatin from Merck Millipore (Billerica, MA, USA). All other chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA) or Merck Millipore. For Western blot analysis, antibodies against cleaved caspase-3 (#9661), cleaved caspase-8 (#9496), B cell lymphoma (Bcl)-2 (#15071), phospho-Bcl-2 (#2824), phospho-p53 (#9284), caspase-4 (#4450), phospho-Janus kinase (JNK) (#9255), and c-Myc (#18683) were procured from Cell Signaling Technology (Danvers, MA, USA). The antibodies against β-actin (#109) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH, #100118) were supplied by GeneTex (Irvine, CA, USA); those against α-tubulin (sc-5286), P21 (sc-6264), P27 (sc-1641), and JNK (sc-571) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). For IHC, the USP14 antibody (#MA5-32821) was purchased from Invitrogen, the USP21 antibody (#17856-1-AP) was purchased from Proteintech (Chicago, IL, USA), and the c-Myc (#ab32072) antibody was purchased from Abcam (Cambridge, UK).
+ Open protocol
+ Expand
4

Regulation of p62, Usp5, and Wt1 in KGN Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human cell line KGN was purchased from Shanghai BinSui Biological Technology Co., Ltd. KGN was cultured in DMEM basic medium (Gibco, C11995500BT) supplemented with 10% fetal bovine serum (FBS, Sigma-aldrich, F8687), 1% penicillin–streptomycin solution (Gibco, 15140-122), and stored at 37℃ in 5% CO2.
According to the manufacturer’s instructions, small interfering RNA (si-p62: F: GUCUCCGAUAUCUGUUAAUTT, R: AUUAACAGAUAUCGGAGACTT; si-Usp5: F: GGAGUUCUUCCUUCACCUUTT, R: AAGGUGAAGGAAGAACUCCTT; si-Wt1: F: AAAUUGUCACUGCUGUGUAGGTT, R: CCUACACAGCAGUGACAAUUUTT) was transfected into KGN cells using Lipofectamine 3000 Transfection Kit (Invitrogen, CN2481208) [72 (link)]. All siRNA and negative control siRNA were purchased from GenaPharma (Suzhou, China).
Unless otherwise specified, FSH (National Hormone and Peptide Program, USA; 10 µg/µL) was added to cell culture for 48 h, and other specific drug concentrations were shown as follows. CQ (17,589 A; 10 µM), MG132 (13,259; 10 µM), PR-619 (13,814; 10 µM), USP5-IN-1 (139,979; 7.5 µM) and CHX (12,320; 10 µM) were both purchased from MedChemExpress.
+ Open protocol
+ Expand
5

Generation and Characterization of p62 Knockout Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
C57BL/6 mice were purchased from the National Institute of Biological Sciences (Beijing, China). We hybridized Foxl2-Cre mice by crossed with p62flox/flox mice to obtain p62flox/flox; Foxl2-Cre mice [64 (link)]. Thus, the resulting p62flox/flox; Foxl2-Cre mice were referred to as p62−/− mice and p62flox/flox females were used as control mice, namely p62+/+ mice. The Foxl2-Cre mice were a gift from Professor Fei Gao, Institute of Zoology, Chinese Academy of Sciences (Beijing, China). Primers to identify knockout mouse genotypes are as follows: p62-seq-F: TGAGAAGGCAGATGGGACAGGGA, p62-seq-R: GCCCAGACATAAGCCACCCACCT; foxl2-Cre-F: TGCTTCTGTCCGTTTGC, foxl2-Cre-F: CCACCGTCAGTACGTGAG. All these mice were housed under controlled temperature (22 °C) and light conditions (14 h light, 10 h darkness; lights on at 07:00 a.m.) and allowed free access to chow and water. The breeding test was performed by crossing p62+/+ and p62−/− female mice with proven fertile males for six months. All drugs were injected intraperitoneally, and the concentrations are shown as follows. PR-619 (13,814; 0.12 µg/g [body weight]), USP5-IN-1 (139,979; 0.255 µg/g [body weight]) were both purchased from MedChemExpress [65 ].
All procedures were conducted in accordance with the guidelines of and approved by the Animal Research Committee of the China Agricultural University.
+ Open protocol
+ Expand
6

Inhibitors of Oesophageal Carcinoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human oesophageal squamous cell carcinoma cell line Kyse30, Kyse450, EC1 and EC109 were cultured in DMEM (BI) medium containing 10% FBS (BI) at 37℃ with 5% CO2. PR‐619 (a pan‐DUB inhibitor), STO‐609 (a CaMKK inhibitor), Compound C (CC) (an AMPK inhibitor) and PYR‐41 (a ubiquitin E1 inhibitor) were purchased from MedChemExpress (MCE) and dissolved in dimethyl sulfoxide (DMSO). Chloroquine (CQ) was purchased from Sigma‐Aldrich and was dissolved in phosphate‐buffered saline (PBS). Bafilomycin A1(BafA1) was purchased from Sigma‐Aldrich and dissolved in DMSO.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!