Pcmv tag3b

Plasmids pGL‐2020, pGL‐1000, pGL‐500, pGL‐121 and pGL‐121∆ISRE were constructed by cloning the PCR‐amplified fragment of the TRIM14 promoter into pGL3‐basic (Promega, Madison, WI, USA), and the primers are listed in Table 1. pGL‐500 mutants were constructed using a site‐directed mutagenesis kit (Toyobo, Osaka, Japan), and the primers used are listed in Table 1. Plasmids IRF‐1, IRF‐2, IRF‐3, IRF‐5 and IRF‐7 were constructed by inserting the coding sequence into the pCDNA3.1 (+) (Thermo Fisher Scientific, Waltham, MA, USA) or pCMV‐Tag3B (Agilent, Santa Clara, CA, USA) vector. The shRNA constructs for IRF‐1 and IRF‐2 were constructed using the pSIREN‐RetroQ vector (Clontech, Mountain View, CA, USA). The target sequence for IRF‐1 was: 5′‐GGGGTACCTACTCAATGAACCT‐3′; and for IRF‐2: 5′‐GGGGTACCTACTCAATG‐AACCT. Sequences of all of the constructs were confirmed by sequencing. Antibodies against IRF‐1, IRF‐2, Myc and Flag were purchased from Santa Cruz Biotechnology (Dallas, TX, USA), α‐tubulin from Sigma‐Aldrich (St. Louis, MO, USA), and TRIM14 antibody from Abcam (Cambridge, UK).

Plasmids used in this study included: pBabe encoding hemagglutinin (HA)-tagged LCMT1 or myc-tagged PME1 (Sontag et al., 2007 (link)); pcDNA3.1 encoding HA-tagged PP2Ac or the L309Δ PP2Ac mutant (Sontag et al., 2007 (link)); pRcCMV encoding a kinase deficient mutant of aPKCζ (aPKCζ^mut) (Sontag et al., 1997 (link)). pcMV-Tag3b (Agilent Technologies) encoding myc-tagged Par3 (Par3^WT) or the Par3 S827A mutant (Par3^S827A) were obtained after subcloning from corresponding SRHis-PAR-3 and SRHis-PAR-3 S827A plasmids (Nagai-Tamai et al., 2002 (link)). All plasmids were verified by sequencing.