Stellaris fish probe designer

Manufactured by Biosearch Technologies

Sourced in United States

The Stellaris FISH Probe Designer is a software tool that enables the design of custom fluorescence in situ hybridization (FISH) probes. It provides a platform for researchers to input their target sequences and generate optimal FISH probe designs.

Automatically generated - may contain errors

Lab products found in correlation

Stellaris fish probe set, by Biosearch Technologies (3 mentions) Tamra dye, by Biosearch Technologies (2 mentions) Quasar 570, by Biosearch Technologies (2 mentions) Cal fluor red 610, by Biosearch Technologies (2 mentions) Prolong gold, by Thermo Fisher Scientific (2 mentions) Fv1000, by Olympus (1 mentions) Smf wa1 60, by Biosearch Technologies (1 mentions) Smf wb1 20, by Vector Laboratories (1 mentions) Vectashield mounting medium, by Vector Laboratories (1 mentions) Quasar 670, by Biosearch Technologies (1 mentions) Fixation permeabilization solution, by Thermo Fisher Scientific (1 mentions) Control igg antibody, by Cell Signaling Technology (1 mentions) Alexafluor 647 anti rabbit secondary antibody, by Thermo Fisher Scientific (1 mentions) Tcs sp8, by Leica camera (1 mentions) Lsm 510 confocal microscope, by Zeiss (1 mentions) Sp dcas9 vpr, by Addgene (1 mentions) Pcdna3, by Thermo Fisher Scientific (1 mentions) Gblock, by Integrated DNA Technologies (1 mentions) Alexa fluor 488 conjugated phalloidin, by Thermo Fisher Scientific (1 mentions) Confocal microscopy, by Leica camera (1 mentions)

23 protocols using stellaris fish probe designer

Fluorescence in situ Hybridization of pfs and mocs1 mRNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

For fluorescence in situ hybridization, custom Stellaris® FISH probes were designed to detect pfs/mocs1 mRNAs by utilizing the Stellaris® FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner. The probes were conjugated to the Quasar670 dye and used in FISH assays as described previously [50 (link)]. Confocal microscopy was performed by using Olympus laser scanning microscope FV1000. For comparing the relative levels of pfs mRNAs in wild-type and pfs mutant flies, fluorescent intensities in the central brain region were measured.
To examine the expression pattern of genomic-pfs tagged with GFP, adult heads were dissected in phosphate buffer. The brains were immediately mounted on glass slides in phosphate buffer and imaged with confocal microscopy using Olympus laser scanning microscope FV1000.

Ramin M., Li Y., Chang W.T., Shaw H, & Rao Y. (2019). The peacefulness gene promotes aggression in Drosophila. Molecular Brain, 12, 1.

+ Open protocol

+ Expand

Quantitative RNA FISH for Murine CCL2

Check if the same lab product or an alternative is used in the 5 most similar protocols

Custom RNA FISH Probes were designed against mouse CCL2 mRNA (NM_011333) utilizing the Stellaris® FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA) available online at www.biosearchtech.com/stellarisdesigner. 10μm sections of prostate from naive and EAP treated mice were hybridized with the Stellaris FISH Probe set pooled by 14 singly labeled mouse CCL2 probes (tgagccaacacgtggatgct, tggggcgttaactgcatctg, tggtgaatgagtagcagcag, ctactcattgggatcatctt, tgctggtgatcctc ttgtag, actacagcttctttgggaca, tctcttgagcttggtgacaa, ttcttggggtcagcacagac, gatctcatttggttccgatc, aaggtgctg aagaccttagg, tttacgggtcaacttcacat, tagtggatgcattagcttca, ctcctacagaagtgcttgag, tagttcactgtcacactggt) with TAMRA dye (Biosearch Technologies, Inc.). Following the manufacturer’s instructions slides were thawed to room temperature and immersed in 3.7% formaldehyde in 1 X PBS for 10min. Slides were washed twice with 1X PBS for 2-5 minutes and permeabilized by incubation in 70% ethanol for 1 hour at room temperature. Slides were washed in wash buffer A (Biosearch Technologies Cat# SMF-WA1-60), followed by probes hybridization overnight at 37°C. Samples were counterstained with DAPI, rinsed in wash buffer B (Biosearch Technologies Cat# SMF-WB1-20), and coverslipped with Vectashield® Mounting Medium (Vector Laboratories Cat #H-1000).

Liu Z., Murphy S.F., Wong L., Schaeffer A.J, & Thumbikat P. (2020). Neuronal/astrocytic expression of chemokine (C-C motif) Ligand 2 is associated with monocyte/macrophage recruitment in male chronic pelvic pain. Pain, 161(11), 2581-2591.

+ Open protocol

+ Expand

Single-Molecule FISH Probes for mCherry mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

We designed single-molecule FISH probes to detect mCherry-mRNA. For this we used the Stellaris FISH probe designer (LGC Biosearch Technologies; www.biosearchtech.com). The set of probes (25 probes) were designed to attach to the full length of mCherry RNA and were coupled to Quasar 670 (a Cy5 analog, LGC Biosearch Technologies). We also designed FISH probes to detect mRNA of endogenous yeast genes to convert TPM values from our 4tU RNA-sequencing data to integer numbers of RNA per cell. For this, we used probes for RPS3 (30 probes coupled to Quasar 670), RPL3 (48 probes coupled to Quasar 570, a Cy3 analog LGC Biosearch Technologies), RPB1 (48 probes coupled to Quasar 670) and RPB3 (40 probes coupled to Quasar 570). The excitation and emmission peaks of these fluorophores are ex. 548/em. 566 nm (Quasar 570) and ex. 647/em. 760 nm (Quasar 670).

Laman Trip D.S., Maire T, & Youk H. (2022). Slowest possible replicative life at frigid temperatures for yeast. Nature Communications, 13, 7518.

+ Open protocol

+ Expand

Single-Molecule FISH for 18S rRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

We designed single‐molecule FISH probes for detecting 18S rRNA (Fig 4H) with the Stellaris^® FISH Probe Designer (Biosearch Technologies, Inc., Petaluma, CA): www.biosearchtech.com/stellarisdesigner. The probes were coupled to CAL Fluor Red 610 (Biosearch Technologies, Inc.).

Maire T., Allertz T., Betjes M.A, & Youk H. (2020). Dormancy‐to‐death transition in yeast spores occurs due to gradual loss of gene‐expressing ability. Molecular Systems Biology, 16(11), e9245.

+ Open protocol

+ Expand

RNA FISH and Immunofluorescence for TH17 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cy3-conjugated lncRNA-GM probes were designed by the Stellaris FISH Probe Designer (Biosearch Technologies). RNA FISH was performed as described previously (19 (link)). T_H17 cells were fixed with fixation/permeabilization solution (eBioscience) for 15 min at room temperature, followed by hybridization with probes according to the Stellaris RNA FISH protocol.
For immunofluorescence analysis, naïve T and T_H17 cells were fixed with fixation/permeabilization solution for 15 min at room temperature and then followed by incubation with anti-FOXO1A antibody (Abcam) or control antibody IgG (Cell Signaling Technology) and Alexa Fluor 647 anti-rabbit secondary antibody (Thermo Fisher Scientific). Images were obtained with a laser scanning confocal microscope (Leica TCS SP8) and analyzed by the LAS X software version 2.0.2.15022.

Chen Y., Liu J., Zhang X., Zhu H., Wang Y., Li Z., Liu Y., Liu S., Liu S., Li N., Chen K, & Cao X. (2022). lncRNA-GM targets Foxo1 to promote T cell–mediated autoimmunity. Science Advances, 8(31), eabn9181.

+ Open protocol

+ Expand

Probing Mouse Hottip RNA Localization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anti-sense oligo probes tiling the mouse Hottip RNA were designed using the web tool from Stellaris FISH Probe Designer (https://www.biosearchtech.com/support/education/stellaris-rna-fish) Biosearch Technologies, CA, USA). Eleven biotinylated oligos were synthesized by Sigma-Aldrich (S6 Table). ChIRP was performed in limb mesenchymal cells as described previously[42 ]. RNA was isolated from 20% of the ChIRPed beads and used for RT-qPCR for Hottip, 7sk and Gapdh specific primers and rest of the sample was used to purify DNA and perform qPCR for Hoxa genes. Primer details are given in S2 Table.

Pradeepa M.M., McKenna F., Taylor G.C., Bengani H., Grimes G.R., Wood A.J., Bhatia S, & Bickmore W.A. (2017). Psip1/p52 regulates posterior Hoxa genes through activation of lncRNA Hottip. PLoS Genetics, 13(4), e1006677.

+ Open protocol

+ Expand

Stellaris FISH Probes for C. elegans

Check if the same lab product or an alternative is used in the 5 most similar protocols

Custom Stellaris FISH probe sets were designed against the entire coding sequence of F19F10.1 (25 non-overlapping probes labeled with CAL Fluor Orange 560 Dye) and pal-1 (25 non-overlapping probes labeled with C3-Fluorescein Dye), using the Stellaris FISH Probe Designer (Biosearch Technologies, Inc, Petaluma, CA, USA). FISH was performed according to the protocol available on the Stellaris website for fixation of embryonic C. elegans material, with the following modification: all steps were performed in 1.5 mL Eppendorf tubes. Hybridization of two non-overlapping probe sets was performed using 125 nM of each probe set contemporaneously. Within 48 hr from completing the hybridization protocol, embryos were mounted on glass slides under #0 coverglass (85–115 µM thickness), supported on each corner by small amounts of plasticine to avoid crushing the embryos. Slides were imaged immediately after mounting with a Zeiss LSM 510 confocal microscope.

Cole A.G., Hashimshony T., Du Z, & Yanai I. (2024). Gene regulatory patterning codes in early cell fate specification of the C. elegans embryo. eLife, 12, RP87099.

+ Open protocol

+ Expand

Designing smFISH Probes for C17H12.8

Check if the same lab product or an alternative is used in the 5 most similar protocols

smFISH probes were designed against C17H12.8 by utilizing the Stellaris FISH Probe Designer (Biosearch Technologies) as detailed in Supplemental Experimental Procedures.

Chikka M.R., Anbalagan C., Dvorak K., Dombeck K, & Prahlad V. (2016). The Mitochondria-Regulated Immune Pathway Activated in the C. elegans Intestine Is Neuroprotective. Cell reports, 16(9), 2399-2414.

+ Open protocol

+ Expand

Antisense lncRNA Functional Analysis

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The sequences of antisense lncRNAs (RP1-261G23.7, VEGF-AS1 and EST AV731492, VEGF-AS2, Supplementary Materials Table S1) were ordered as gBlocks from Integrated DNA Technologies (IDT, Coralville, IA, USA) and subcloned into pcDNA3.1 (+) (Thermo Fisher Scientific, Waltham, MA, USA) using EcoRV (NEB) and XbaI (NEB) restriction sites. pcDNA3.1-GFP was used as a control. SgRNAs targeting VEGF-AS2 putative promoter were designed (Supplementary Materials Table S2), ordered from IDT and subcloned into pcDNA3.1-H1sgRNA described in [39 (link)]. SgRNA targeting alpha-1 antitrypsin (target site does not have a PAM sequence) was used as a control (Supplementary Materials Table S2). SP-dCas9-VPR was obtained from Addgene (Addgene plasmid #63798) [19 (link)]. Antisense PTOs and antisense oligonucleotides with 3′-Biotin modification targeting VEGF-AS1 and VEGF-AS2 were designed with Sfold software or Biosearch Technologies’ Stellaris FISH Probe Designer, respectively, and ordered from IDT (Supplementary Materials Table S2). In PTO experiments, miRN367 targeted [40 (link),41 (link)] antisense PTO was used as a control (Supplementary Materials Table S2).

Nieminen T., Scott T.A., Lin F.M., Chen Z., Yla-Herttuala S, & Morris K.V. (2018). Long Non-Coding RNA Modulation of VEGF-A during Hypoxia. Non-Coding RNA, 4(4), 34.

+ Open protocol

+ Expand

ChIP and FISH Probe Design for lncRNA

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP was performed as described previously [34 (link)]. The online Biosearch Technologies’ Stellaris FISH Probe Designer was used to design antisense oligo probes tiling NEAT1–1 RNA. The probe oligos were synthesized with a 3′-Biotin-TEG modification and purified by HPLC.

Wen S., Wei Y., Zen C., Xiong W., Niu Y, & Zhao Y. (2020). Long non-coding RNA NEAT1 promotes bone metastasis of prostate cancer through N6-methyladenosine. Molecular Cancer, 19, 171.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!