Small interfering RNA (siRNA) duplexes targeting human Hes1 sequences and a scrambled siRNA were purchased from Sigma-Aldrich. Transfection of the siRNA duplexes was performed by TransIT-TKO Transfection Reagent (Takara, Kusatsu, Shiga, Japan) according to the manufacturer’s instructions.
Transit tko transfection reagent
Manufactured by Takara Bio
Sourced in Japan
The TransIT-TKO Transfection Reagent is a cationic lipid-based transfection reagent designed to deliver nucleic acids, including plasmid DNA, siRNA, and mRNA, into a variety of cell types. It facilitates the efficient uptake and expression of the delivered genetic material within the target cells.
Automatically generated - may contain errors
3 protocols using transit tko transfection reagent
1
Silencing Hes1 Gene Expression
2
c-Myc Knockdown in Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells (5×104/well) were seeded into six-well plates and allowed to grow to 90% confluence. Transient transfections of c-Myc siRNAs were performed for 6 h with TransIT-TKO transfection reagent (Takara Bio, Inc., Otsu, Japan) according to the manufacturer's instructions. The siRNAs were designed to form 19-bp double-stranded RNA with 2 thymine overhangs at each 3′ end of RNA. The following 3 targeting sequences of c-Myc siRNA were used: siRNA 1 sense, 5′-GCUUCACCAACAGGAACUAUU-3′ and antisense, AACGAAGUGGUUGUCCUUGAU (region: 586–605 bp); siRNA 2 sense, 5′-GGCGAACACACAACGUCUUUU-3′ and antisense, 5′-AACCGCUUGUGUGUUGCUGUU (region: 1,636–1,655 bp); and siRNA 3 sense, 5′-GGAAACGACGAGAACAGUUUU-3′, and antisense, 5′-AACCUUUGCUGCUCUUGUCAA-3′ (region: 1,831–1,850 bp). Alexa 488-conjugated siRNA duplex (Qiagen, Hilden, Germany) was used to determine the transfection efficiency.
3
Plasmid Transfection Using Lipofectamine and TransIT-TKO
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lipofectamine 2000 transfection reagent (Invitrogen, CA, USA) was employed to transfect plasmids into cells. MiRNA inhibitors were transfected into cells using TransIT‐TKO transfection reagent (TaKaRa, Dalian, China).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!