The largest database of trusted experimental protocols

Scramble sirna

Manufactured by Eurogentec

Scramble siRNA is a laboratory tool used to generate a non-targeting control sequence in RNA interference experiments. It is designed to have no known mammalian gene targets.

Automatically generated - may contain errors

3 protocols using scramble sirna

1

MCF-7 Breast Cancer Cell Culture and Manipulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
MCF-7 cells were maintained at 37 °C in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum, 1% nonessential amino acids and 2% of penicillin/streptomycine. The cell line has been authenticated by Eurofins. Prior to treatment with ligands, cells were grown for 48 h in phenol red-free medium supplemented with 10% charcoal-stripped serum (Biowest), in order to remove steroid hormones or in serum-free medium for IGF-1 treatment. The cells were then treated for different times with E2 (Sigma) 10–8 M or IGF-1 (4×10–5 µg/µl) from Peprotech. When stated, cells were treated with the PRMT1 inhibitor MS023 (Tocris Bioscience).
For knockdown experiments, specific siRNAs or scramble siRNA (Eurogentec) (50 nM) were transfected into MCF-7 cells using the lipofectamine 2000 reagent (Invitrogen). The targeted sequences are given in Supplementary Table 1. After 72 h of transfection, proteins were analyzed.
For overexpression experiments, pSG5-Flag-tagged vectors were transfected into MCF-7 cells using Jetprime reagent (Ozyme) according to the manufacturer’s protocol. Thirty hours after transfection, cells were collected and analyzed.
+ Open protocol
+ Expand
2

Knockdown of Furin in Breast Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
ERα+ cells lines (MCF7, Cama1) and ERα– cell lines (MDA-MB-231, Skbr3 and HBL100) were obtained from the ATCC. All of the cell lines were maintained at 37 °C in the appropriate medium supplemented with 10% foetal bovine serum, 1% non-essential amino acid and 2% penicillin/streptomycin. All cell lines were regularly tested for mycoplasma contamination. We also used frozen tumours from human breast cancer-derived xenografts (PDX) from Dr. Marangoni. HBCc-12A- (ERα–) and HBCx-3-expressing (ERα+ ) cell lines were established from the human breast cancer xenografts as described by Marangoni et al.26 (link)For knockdown experiments, furin-specific siRNAs from ThermoFisher Scientific (ambion s9988 and s9987) siRNA furin 1: sens: 5′-GGGCCUUCAUGACAACUCATT-3′; anti sens: UGAGUUGUCAUGAAGGCCCAG; siRNA furin 2: sens: GGUGGAAAAUGGACUGGCUTT; anti sens: AGCCAGUCCAUUUUCCACCTT; the scramble siRNA (Eurogentec) (20 nM) was transfected into MCF‐7 and MDA-MB-231 cells using the lipofectamine 2000 reagent according to the manufacturer’s instructions (Invitrogen).
+ Open protocol
+ Expand
3

Molecular Regulation of Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
All of the cell lines were maintained at 37°C in the appropriate medium supplemented with 10% fetal bovine serum and 2% Penicillin/Streptomycin. For knockdown experiments, PRMT5-, LKB1- and MEP50-specific siRNAs or the scramble siRNA (Eurogentec) (50 nM) were transfected into MCF-7 cells using the lipofectamine 2000 reagent (Invitrogen). The targeted sequences are given in the supplemental data Table 1. 72 hr after transfection, proteins were analyzed. For overexpression experiments, pcDNA3.1 V5-tagged vectors and pSG5 Flag-tagged vectors were transfected using the XtremeGENE reagent (Roche). Forty eight hours after transfection, cells were analyzed.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!