Multina system

Total RNA was extracted from myoblasts using RNeasy Mini Kit (Qiagen, Hilden, Germany) according to manufacturer's protocol. Then reverse transcriptase polymerase chain reaction (RT-PCR) was performed on 100 ng of total RNA for 35 cycles of amplification using One-Step RT-PCR kit (Qiagen, Chatsworth, CA) following manufacturer's instructions with 0.6 mM of forward primer (exon-5 CTGACTCTTGGTTTGATTTGGA) and reverse primers (exon-10 TGCTTCGGTCTCTGTCAATG). Amplicon detection was carried out with a microchip electrophoresis system in the MultiNA system (Shimadzu, Kyoto, Japan).

Detection of DIRC3 genetic variants was performed by quantitative polymerase chain reaction (qPCR) using the TaqMan SNP Genotyping Assay kit (Thermo Fisher Scientific) and sequencing of PCR products. The region of DIRC3 containing the polymorphism was amplified using the following oligonucleotide primer pair: forward, 5′-CAGCCTTTCATCCAGCAGGACAACAG-3′ and reverse, 5′-TCCACTGGGCGTCTCAACTACAATCTG-3′. The amplification conditions consisted of an initial denaturation at 95 °C for 15 min and then 39 cycles of denaturation at 95 °C for 15 s, annealing at 61 °C for 15 s, and extension at 72 °C for 15 s, followed by a final extension at 72 °C for 2 min. PCR was performed using a Veriti Thermal Cycler (Applied Biosystems, Foster City, CA, USA). PCR products were separated by microchip electrophoresis using the MultiNA System (Shimadzu Corporation, SHIM-POL, Poland). Amplified PCR products were purified using FastAP and Exonuclease I (Thermo Fisher Scientific). After purification of the resulting PCR products, sequencing was performed using the BigDye Terminator v1.1 Cycle Sequencing kit (Life Technologies/Thermo Fisher Scientific), and the same forward and reverse primers. The primers were diluted at a ratio of 8:42 μL in water, and PCR products were separated and analyzed on an ABI 3130 Automatic Capillary DNA Sequencer (Applied Biosystems).