Log In Sign up
The largest database of trusted experimental protocols

Rna stat 60

Manufactured by Thermo Fisher Scientific
Visit Supplier

RNA STAT-60 is a reagent for the isolation of total RNA from various biological samples. It is a monophasic solution of phenol and guanidine isothiocyanate that maintains the integrity of RNA while disrupting cells and dissolving cell components.

Automatically generated - may contain errors

Lab products found in correlation

Rna stat 60, by Tel-Test (3 mentions) Dnase 1, by Thermo Fisher Scientific (2 mentions) Rnase a, by Merck Group (2 mentions) Rnase one, by Promega (2 mentions) Taqman gene expression assay, by Thermo Fisher Scientific (2 mentions) Superscript vilo, by Thermo Fisher Scientific (1 mentions) Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions) Power sybr green master mix, by Thermo Fisher Scientific (1 mentions) Lightcycler faststart dna master sybr green 1, by Roche (1 mentions) Imagequant, by GE Healthcare (1 mentions) Random primer, by Thermo Fisher Scientific (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Multiscribe reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Glycoblue, by Thermo Fisher Scientific (1 mentions) Ribogreen reagent, by Thermo Fisher Scientific (1 mentions) Hybond n membrane, by GE Healthcare (1 mentions) T4 polynucleotide kinase, by Thermo Fisher Scientific (1 mentions) Hybond, by Cytiva (1 mentions) Lightcycler 480, by Roche (1 mentions) Rq1 dnase, by Promega (1 mentions)

14 protocols using rna stat 60

1

Liver RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from the liver using RNA STAT-60 (Fischer Scientific) and 500 ng of RNA was reverse transcribed into cDNA using a kit (SuperScript VILO; Invitrogen). qPCR was performed in duplicate using QuantStudio 6 Flex system. Power SYBR Green Master Mix, Taqman Universal PCR Master Mix, and Taqman gene expression assays were purchased from Thermo Fischer. Relative mRNA levels were calculated using standard-curve methods and were normalized to the level of cyclophilin and 18S to show consistency. Data shown in the figures are all normalized to cyclophilin.
Ritter M.J., Amano I., Imai N., Soares De Oliveira L., Vella K.R, & Hollenberg A.N. (2021). Nuclear Receptor CoRepressors, NCOR1 and SMRT, are required for maintaining systemic metabolic homeostasis. Molecular Metabolism, 53, 101315.
+ Open protocol
+ Expand
2

Purification and Analysis of T. brucei RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was purified from 100 million T. brucei cells using RNA STAT-60 (Tel. Test Inc.) twice and treated with 10 units of DNase I (Thermo Fisher Scientific) followed by another round of purification with RNA STAT-60. The resulting RNA sample was treated with or without 20 units of RNase One (Promega) and 20 μg of RNase A (Sigma) (as negative controls). For northern blotting, 10 μg of RNA samples were loaded in each lane. For slot blot hybridization, 2 μg of RNA was spotted on the Nylon membrane. RNA samples were denatured at 65°C for 10 min in the presence of formamide and formaldehyde before separated by electrophoresis. To prepare the (CCCTAA)n- [or (TTAGGG)n-] specific probe, the Klenow primer extension reaction was performed using a duplex TTAGGG repeats as the template in the presence of dA, dT and radioactive dC (or radioactive dG).
Nanavaty V., Sandhu R., Jehi S.E., Pandya U.M, & Li B. (2017). Trypanosoma brucei RAP1 maintains telomere and subtelomere integrity by suppressing TERRA and telomeric RNA:DNA hybrids. Nucleic Acids Research, 45(10), 5785-5796.
+ Open protocol
+ Expand
3

Quantitative Assessment of Glycosylation Genes

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from 1 × 106 cells treated with RNA Stat-60 (Thermo Fisher Scientific). Following deoxyribonuclease treatment and conversion to cDNA, real-time polymerase chain reaction was performed using LightCycler FastStart DNA Master SYBR Green I (Roche Diagnostics Corp.). Gene-specific primers were used for detection of transcripts of C1GALT1, COSMC, and ST6GALNAC2.14 (link), 18 (link) Primers for beta-actin amplification were purchased from R&D Systems (Minneapolis, MN) and used for quantitation of the housekeeping gene to normalize gene-expression data. Real-time polymerase chain reaction was performed for 42 cycles of denaturation at 95 °C, annealing at 60 °C, and extension at 72 °C.
Suzuki H., Moldoveanu Z., Julian B.A., Wyatt R.J, & Novak J. (2019). Autoantibodies Specific for Galactose-Deficient IgA1 in IgA Vasculitis With Nephritis. Kidney International Reports, 4(12), 1717-1724.
+ Open protocol
+ Expand
4

Quantifying TERRA expression by northern blotting

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was purified from 80 to 100 million cells using RNA STAT-60 (Tel. Test Inc.) twice and treated with 10 units of DNase I (ThermoFisher), followed by another round of purification with RNA STAT-60. The resulting RNA sample was treated with or without 20 units of RNase One (Promega) and 20 μg of RNase A (Sigma). For northern blotting, 10 μg of RNA was loaded in each lane. After electrophoresis, RNA was transferred to a Nylon membrane and hybridized with a radiolabeled (CCCTAA)4 oligo probe. The hybridization intensity (whole lane) was quantified for each sample using ImageQuant (GE) and the relative amount of TERRA level was calculated. The hybridization signals (TERRA species bigger than the largest rRNA precursor) were counted to estimate the average size of TERRA in each sample according to (53 (link)).
Saha A., Gaurav A.K., Pandya U.M., Afrin M., Sandhu R., Nanavaty V., Schnur B, & Li B. (2021). TbTRF suppresses the TERRA level and regulates the cell cycle-dependent TERRA foci number with a TERRA binding activity in its C-terminal Myb domain. Nucleic Acids Research, 49(10), 5637-5653.
+ Open protocol
+ Expand
5

RNA Isolation and Quantification from PBMCs and Colonic Biopsies

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from PBMCs or Jurkat cells using TRIzol (Life Technologies). One μl of GlycoBlue (Life Technologies) was added before RNA precipitation with isopropanol. RNA was washed with 70% ethanol and resuspended in nuclease-free water. Equal amounts of total RNA were reverse-transcribed to generate cDNA using MultiScribe Reverse Transcriptase and random primers (Applied Biosystems). To extract RNA from colonic biopsies, each sample was immediately placed into RNA Stat-60 (Tel-Test) then placed on ice. Samples were stored at -80°C, and assays were performed within 6 months of acquisition. Colonic pinch biopsies were homogenized manually in the presence of RNA Stat-60 using chilled Kontes-Duall tissue grinders (Fisher Scientific). After the addition of chloroform and centrifugation, a crude RNA extract was obtained. The resultant aqueous phase was mixed with an equal volume of 70% ethanol; the samples were then loaded onto RNeasy Lipid Tissue Mini columns (Qiagen) according to the manufacturer's protocol. RNA was eluted in 40 μl of TE buffer. RNA was quantified using Ribo-green reagent (Life Technologies).
Boland B.S., Widjaja C.E., Banno A., Zhang B., Kim S.H., Stoven S., Peterson M.R., Jones M.C., Su H.I., Crowe S.E., Bui J.D., Ho S.B., Okugawa Y., Goel A., Marietta E.V., Khosroheidari M., Jepsen K.L., Aramburu J., Lopez-Rodriguez C., Sandborn W.J., Murray J.A., Harismendy O, & Chang J.T. (2015). Immunodeficiency and Autoimmune Enterocolopathy Linked to NFAT5 Haploinsufficiency. Journal of immunology (Baltimore, Md. : 1950), 194(6), 2551-2560.
+ Open protocol
+ Expand
6

Quantifying mRNA Expression via Northern Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total liver RNA was prepared using RNA STAT 60 (Fisher Scientific, Catalog # CS-111) as previously described [165 (link)]. For Northern blotting, 12μg of total RNA was denatured at 50°C with glyoxal before separating on a 1.5% agarose-formaldehyde gel using a vertical gel apparatus. Fractionated RNA was transferred to Hybond-N+ membranes (GE Healthcare) overnight and hybridized to [α-32P]dCTP radiolabeled cDNA probes prepared using a Random Primed DNA labeling kit (Sigma, 11004760001). The following day membranes were washed and exposed to Blue Lite Film (ISC BioExpress, F-9024) film with intensifying screens at -80°C for 8–24 hours, after which they were stripped and re-probed with a radiolabeled oligonucleotide probe specific for 18S rRNA (5′ GCCGTGCGTACTTAGACATGCATG 3′ corresponding to nucleotides 50–73 of the rat ribosomal RNA gene) end-labeled with [γ-32P]ATP using T4 polynucleotide kinase (Fisher, Pittsburgh, PA) or a cyclophilin A-specific cDNA probe for assessment of RNA loading. The 840bp cDNA probe for Rps6 was obtained by NotI/SalI digestion of plasmid pCMV-Sport6 containing mouse Rps6 cDNA (ATCC Product # 10538869). The 4.8kb cDNA probe for mouse Myc was isolated and purified by digesting plasmid pSV-c-Myc-1 (ATCC # 41029) with BamHI and XbaI. The 721bp mouse Ppia/cyclophilin A-specific probe was obtained from Ambion (AM 7375).
Comerford S.A., Hinnant E.A., Chen Y, & Hammer R.E. (2023). Hepatic ribosomal protein S6 (Rps6) insufficiency results in failed bile duct development and loss of hepatocyte viability; a ribosomopathy-like phenotype that is partially p53-dependent. PLOS Genetics, 19(1), e1010595.
+ Open protocol
+ Expand
7

RNA Extraction and Quantitative PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
For RNA collection, cells were washed twice with DPBS and then lysed with RNA STAT 60 (Fisher Scientific: NC9884083). Chloroform (Sigma-Aldrich: 650498) was used for phase separation. RNA was precipitated with isopropanol (Thermo Fisher Scientific: AC327272500), washed with 75% ethanol, and solubilized in DEPC H2O (VWR: 101076–146). RNA samples was treated with RQ1 DNAse (Promega: M6101) and cDNA was synthesized using SuperScipt III Reverse Transcriptase (Thermo Fisher Scientific: 18080093) according to the manufacturer’s instructions. Quantitative PCR was performed on a Roche LightCycler 480 using KAPA SYBR FAST qPCR MasterMix (Roche: KK4611).
Relative gene expression level was normalized to CycloB. The following primers (IDT) were used:
John S.V., Seim G.L., Erazo-Flores B.J., Steill J., Freeman J., Votava J.A., Arp N.L., Qing X., Stewart R., Knoll L.J, & Fan J. (2023). Macrophages undergo functionally significant reprograming of nucleotide metabolism upon classical activation. bioRxiv.
+ Open protocol
+ Expand
8

RNA Extraction and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from HeLa and K562 cells using RNA STAT-60 (Fisher Scientific, Cat. #NC9489785). Reverse transcription was performed using a First-Strand cDNA Synthesis kit (New England Biolabs, Cat. #E6560) and random primers, according to manufacturer’s instructions. RNA expression levels were quantified by qPCR with a SYBR Green reagent (Thermo Fisher Scientific, Cat. #K0223). Primers for qPCR are shown in Table S2.
Zhang R., Bons J., Scheidemantle G., Liu X., Bielska O., Carrico C., Rose J., Heckenbach I., Scheibye-Knudsen M., Schilling B, & Verdin E. (2023). Histone malonylation is regulated by SIRT5 and KAT2A. iScience, 26(3), 106193.
+ Open protocol
+ Expand
9

Quantitative RT-PCR for Fgf21 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from tissue using RNA-STAT60 reagent, and RNA was reverse-transcribed into cDNA (Invitrogen). Gene expression (Mouse Fgf21 - forward: ctctaggtttctttgccaacag; reverse: aagctgcaggcctcaggat) was measured with an Applied Biosystems 7900HT Sequence Detection System using the CT assay and normalized to Gapdh as described (Bookout et al., 2006 ).
Song P., Zechner C., Hernandez G., Cánovas J., Xie Y., Sondhi V., Wagner M., Stadlbauer V., Horvath A., Leber B., Hu M.C., Moe O.W., Mangelsdorf D.J, & Kliewer S.A. (2018). The Hormone FGF21 Stimulates Water Drinking in Response to Ketogenic Diet and Alcohol. Cell metabolism, 27(6), 1338-1347.e4.
+ Open protocol
+ Expand
10

Synovial Tissue Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
For analysis of synovial tissue gene expression, total RNA was isolated from biopsies of 19 patients with RA using RNA STAT-60 (Invitrogen) according to the manufacturer’s instructions, and cleaned using RNeasy columns (Qiagen) and DNAse treatment. RNeasy Micro Kit (Qiagen) was used for RNA extraction from FLS. Quantity and purity of RNA was assessed using a Nanodrop spectrophotometer (Nanodrop Technologies). About 150–500 ng of RNA was reverse transcribed using a First-Strand cDNA synthesis kit (Thermo Scientific) and quantitative (q)PCR reaction was performed using Fast SybrGreen PCR Master Mix (Applied Biosystems). Sequences of the primers used are listed in online supplementary table 1. For qPCR array analysis, 1000 ng of RNA was reverse transcribed using an RT2 HT First Strand Kit (Qiagen), cDNA was mixed with SybrGreen qPCR Mastermix (Qiagen) and expression of 84 genes involved in FLS activation was analysed using RT2 Profiler customised qPCR arrays. qPCR reactions were performed on a StepOne Plus Real-Time PCR System (Applied Biosystems) and relative mRNA expression was calculated using StepOne Software V.2.1 (Applied Biosystems) as the ratio between the gene of interest and the expression of housekeeping gene(s) using the ΔΔCT method.
Angiolilli C., Grabiec A.M., Ferguson B.S., Ospelt C., Fernandez B.M., van Es I.E., van Baarsen L.G., Gay S., McKinsey T.A., Tak P.P., Baeten D.L, & Reedquist K.A. (2014). Inflammatory cytokines epigenetically regulate rheumatoid arthritis fibroblast-like synoviocyte activation by suppressing HDAC5 expression. Annals of the rheumatic diseases, 75(2), 430-438.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!