Mice with a targeted miR-193b locus have been described (Feuermann et al., 2013 (link)). Mammary tissue from nulliparous mice was chopped and digested at 37°C, shaking at 200rpm for 2 hrs in complete EpiCult-B medium (EpiCult-B medium with 5% fetal bovine serum, 10 ng/mL recombinant human epidermal growth factor, 10 ng/mL recombinant human basic fibroblast growth factor, 0.0004% heparin) supplemented with 300 U/mL collagenase 100 U/mL hyaluronidase. After lysis of red blood cells in NH4Cl, a single-cell suspension was obtained by sequential dissociation of the fragments with pre-warmed 0.25% trypsin-EDTA for 1–2 min, followed by pre-warmed 5 mg/mL dispase II plus 0.1 mg/mL DNase I (DNase; Sigma) for 2 min, and filtration through a 70-μm mesh. All reagents were from StemCell Technologies, Inc. unless otherwise specified. Defined numbers of isolated MECs were injected into the cleared fat pads of immunocompromised hosts (nu/nu athymic). Four weeks later the transplants were harvested and outgrowths were evaluated on carmine stained whole mounts. Stem cell frequencies were determined by ELDA (Hu and Smyth, 2009 (link)).
Dnase 1 dnase
Manufactured by Merck Group
DNase I is a laboratory enzyme that catalyzes the hydrolysis of DNA into smaller fragments. It is commonly used in various molecular biology and biotechnology applications to remove unwanted DNA.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using dnase 1 dnase
1
Isolation and Transplantation of Murine Mammary Epithelial Cells
2
Isolation and Analysis of Mouse Mammary Epithelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse mammary epithelial cells were prepared according to the manufacturer's protocol
(StemCell Technologies, Vancouver, Canada). Briefly, following removal of the lymph
node, mammary glands dissected from 10-week-old virgin female mice were digested in
EpiCult-B with 5% fetal bovine serum (FBS), 300 U/ml collagenase, and 100 U/ml
hyaluronidase for 8 hr at 37°C. After vortexing and lysis of the red blood cells
in NH4Cl, mammary epithelial cells were obtained by sequential
dissociation of the fragments by gentle pipetting for 1–2 min in 0.25%
trypsin, and 2 min in 5 mg/ml dispase plus 0.1 mg/ml DNase I (DNase; Sigma). Total
RNA was isolated from mammary epithelial cells. Complementary DNA was prepared using
the MMLV cDNA synthesis kit (Promega). Quantitative RT-PCR was performed using the
SYBR-green detection system (Roche). Primers were as follows:
Msi2 forward primer: ACGACTCCCAGCACGACC; Msi2reverse primer: GCCAGCTCAGTCCACCGATA.
K8 forward primer: ATCAAGAAGGATGTGGACGAA; K8Reverse primer: TTGGCAATGTCCTCGTACTG.
K14 forward primer: CAGCCCCTACTTCAAGACCA; K14Reverse primer: AATCTGCAGGAGGACATTGG.
K18 forward primer: TGCCGCCGATGACTTTAGA; K18 Reverse primer:
TTGCTGAGGTCCTGAGATTTG.
(StemCell Technologies, Vancouver, Canada). Briefly, following removal of the lymph
node, mammary glands dissected from 10-week-old virgin female mice were digested in
EpiCult-B with 5% fetal bovine serum (FBS), 300 U/ml collagenase, and 100 U/ml
hyaluronidase for 8 hr at 37°C. After vortexing and lysis of the red blood cells
in NH4Cl, mammary epithelial cells were obtained by sequential
dissociation of the fragments by gentle pipetting for 1–2 min in 0.25%
trypsin, and 2 min in 5 mg/ml dispase plus 0.1 mg/ml DNase I (DNase; Sigma). Total
RNA was isolated from mammary epithelial cells. Complementary DNA was prepared using
the MMLV cDNA synthesis kit (Promega). Quantitative RT-PCR was performed using the
SYBR-green detection system (Roche). Primers were as follows:
Msi2 forward primer: ACGACTCCCAGCACGACC; Msi2reverse primer: GCCAGCTCAGTCCACCGATA.
K8 forward primer: ATCAAGAAGGATGTGGACGAA; K8Reverse primer: TTGGCAATGTCCTCGTACTG.
K14 forward primer: CAGCCCCTACTTCAAGACCA; K14Reverse primer: AATCTGCAGGAGGACATTGG.
K18 forward primer: TGCCGCCGATGACTTTAGA; K18 Reverse primer:
TTGCTGAGGTCCTGAGATTTG.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!