Abi prism 7900

The control cells were cultured with regular DMEM and the experimental cells were cultured with extra 10 ug/L rhIL-6. Cells were harvested at 12, 24, and 72 h. Total RNA extraction, reverse-transcription, and real-time RT-PCR reactions were carried out according to the manufacturer’s instructions (TaKaRa, Japan; ABI PRISM 7900, America). All data were analyzed using ABI PRISM SDS 2.0 software (Applied Biosystems). The mRNA expressions of the target genes were represented using the ΔCt method; B-actin was co-amplified as the housekeeping gene.^{15 (link)} Every gene level was transformed into the ratio of experimental group to control group at the same time point during statistical analyzing. The oligonucleotide primers for BMP2, BAP, OPN, and OPG were listed in Table 1.
BAP, bone specific alkaline protein; BMP2, bone morphogenetic protein 2; OPG, osteoprotegerin; OPN, osteopontin.

TRIzol Reagent (Takara) was used to isolate complete RNA from HCC tissues, normal tissues, and cell lines, and genomic DNA (gDNA) was extracted using FastPure DNA Isolation (Vazyme). Nanodrop 2000 was used to examine the concentration and purity of RNA samples (Thermo Fisher Scientific). Reverse transcriptions of circRNA and mRNA were carried out with the PrimeScript RT Master Mix (Takara) and designed primers, with GAPDH as an internal control. Reverse transcriptions for miRNA were carried out with the Bulge‐LoopTM miRNA qRT‐PCR Starter Kit (RIBOBIO) and unique stem‐loop primers, with U6 acting as an internal control, and cDNA amplification was achieved with an ABI Prism 7900 sequence detection system and TB Green Premix Ex Taq II (Takara; Applied Biosystems). Each sample was obtained three times. To compare relative quantification of circRNA, miRNA, and mRNA expression to an internal regulation, the 2^−ΔΔCT method was used. The primer for GAPDH was Forward 5′‐ GGAGCGAGATCCCTCCAAAAT‐3′; Reverse: 5′‐ GGCTGTTGTCATACTTCTCATGG‐3′, for circ‐0008194, Forward 5′‐ CTCGTCGCCGCCAGTAG ‐3′; and Reverse: 5′‐ TCTTTGCAGGATTCCGCTCA ‐3′.

RNA was isolated from cells using Total RNA isolation kit (Norgen Biotek Corp, Thorold, Ontario, Canada) following the manufacturer’s instructions. Briefly, first-strand cDNA was prepared using 1–2ug of total RNA, the Superscript III RT kit and random hexamer primers (Invitrogen, Carlsbad, CA, USA) in a total volume of 25 µL. Reverse transcription reaction was carried out for 90 minutes at 50°C and an additional 10 minutes at 55°C. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed on an ABI Prism 7900 sequence detection system using SybrGreen reagents (Takara Bio Company, Clontech, Mountain View, CA, USA) and TaqMan^® Gene Expression Master Mix (Life Technologies, Madrid, Spain). Primers used were previously described.20 (link),22 (link),23 (link)

Total RNA (1–2 μg) was reverse-transcribed with Superscript III RT kit according to the manufacturer's instructions. Real-time PCR (RT-PCR) was performed in an ABI Prism 7900 sequence detection system using SybrGreen reagents (Takara Bio Company) and TaqMan® Gene Expression Master Mix (Life Technologies). Values were normalized to GAPDH RNA levels for human cells and mouse kidney. Bcl-2, p21 and p53 were analysed with the TaqMan Gene Expression assay (Applied Biosystems). Thermal profiles used were previously published [51] (link), [52] (link). The primers for all the other mRNAs are listed in Table 4 of supplemental material.