Mysticq universal pcr primer

Macrodissection of target areas was performed using multiple 10 µm thick formalin-fixed paraffin-embedded (FFPE) tissue sections. Total RNA was extracted using miRNeasy FFPE Kit (Qiagen®, Hilden, Germany), according to manufacturer’s instructions. RNA samples were quantified using QuantiFluor^® (Promega, Madison, WI, USA). For qRT-PCR 100 ng were required.
For the analysis of the miRNAs miScriptR II RT (Qiagen^®, Hilden, Germany) and SYBR^® Green PCR Master mix (Applied Biosystems^TM, Foster City, CA, USA) was used according to the manufacture’s protocol. qRT-PCR was carried out in 96-well plates using Quantstudio^TM7 Flex Real-Time PCR (Applied Biosystems^TM, Foster City, CA, USA), according to the recommended protocol, starting at 95 °C for 20 s, followed by 40 cycles at 95 °C for 15 s, 50 °C for 30 s and 72 °C for 30 s and terminated at 72 °C for 15 s.
For the analysis of miRNAs the following primers were used: hsa-miR-371a-3p, GUGCCGCCAUCUUUUGAGUGU; hsa-miR-375-3p, UUUGUUCGUUCGGCUCGCGUGA; hsa-miR-375-5p, GCGACGAGCCCUCGCACAAACC; 5s rRNA, GGCCAUACCACCCUGAACGC.
5s rRNA (MystiCq^® Universal PCR Primer, Sigma-Aldrich, St. Louis, MO, USA) was used for quantification, RNA of tumor-free tissue as a positive control. All experiments were done in triplicates. miRNA levels were determined according to the ∆∆C_T method.

RT-qPCR reactions were performed in 20 µl reaction mixture volumes using the SYBR-Green master mix reagent (Applied Biosystems; Thermo Fisher Scientific, Inc.) on the ABI Prism 7500 sequence-detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). qPCR conditions were as follows: one cycle at 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec and 60°C for 1 min. Forward primers for each miRNA (MystiCq microRNA qPCR Assay Primer) were purchased from Sigma-Aldrich; Merck KGaA, and MystiCq Universal PCR Primer (product no. MIRUP; Sigma-Aldrich; Merck KGaA) was used as a reverse primer for the RT-qPCR reactions. Pre-designed primers specific for RANKL, IL-1β, IL-6, PTHrP, TNF, NFATc1, OSCAR, β3-integrin, cathepsin-K and TRAP were obtained from Invitrogen; Thermo Fisher Scientific, Inc. Primer sequences are listed in Table I. The obtained values were normalized to those for SNORD43 (product no. MIRCP00004; Sigma-Aldrich; Merck KGaA) for miRNA and β-actin for other genes, and expression levels were quantified using the 2^−∆∆Cq method (24 (link)).