Seqstudio 3200 genetic analyzer

The PCR mixture contained 10× Gold buffer (Applied Biosystems, USA), 2 μL of 25 mM MgCl₂, 0.5 μL of 10 mM dNTPs, 0.5 + 0.5 μL of 10 μM L15995 + H16498, 0.2 μL of 5 U/μL AmpliTag Gold DNA polymerase (Applied Biosystems, USA), 0.1–1 ng of DNA, and H₂O to a final volume of 25 μL. The PCR program was as follows: 95 °C for 10 min, 40× (95 °C for 15 s, 55 °C for 30 s, 72 °C for 1 min), and 72 °C for 30 min.
PCR was performed using a MasterCycler Nexus gradient thermocycler (Eppendorf, Germany). The resulting amplicons were visualized using agarose gel electrophoresis. DNA clean-up of the amplified fragments excised from the gel was performed using a Zymoclean Gel DNA recovery Kit (ZymoResearch, USA). Sanger sequencing was performed using a SeqStudio 3200 Genetic Analyzer (Applied Biosystems, USA). Raw data processing was performed using Sequencing Analysis Software v6.0 (Applied Biosystems, USA).

The primers used for the amplification of mitochondrial-DNA-control-region-length polymorphisms have been described by Pun et al. [29 (link)]. Primer sequences: L15995 5′CTCCACTATCAGCACCCAAAG 3′; H16498 5′CCTGAAGTAAGAACCAGATG 3′.
The PCR mixture contained 1.25 μL of GoldStar 10× buffer (Promega, Madison, WI, USA), 10 μM L15995 + H16498 and 0.5 + 0.5 μL, and the primer L15995 was fluorescently labeled with 5-FAM, 0.25 μL (5 U/μL) of AmpliTag Gold DNA polymerase (Applied Biosystems, San Francisco, CA, USA), 10 pg of DNA, and H₂O to a final volume of 12.5 μL. The PCR program was as follows: 95 °C for 10 min, 32× (95 °C for 15 s, 55 °C for 30 s, 72 °C for 1 min), and 72 °C for 30 min.
PCR was performed using a MasterCycler Nexus gradient thermocycler (Eppendorf, Germany). The resulting amplicons were visualized using capillary electrophoresis (SeqStudio 3200 Genetic Analyzer; Applied Biosystems, USA) under the following parameters: G5 matrix, 12 µL formamide, 0.4 µL LIZ 1200 (Applied Biosystems, USA), 1 µL of PCR product. Raw data processing was performed using GeneMapper5 (Applied Biosystems, USA).