D4013

Manufactured by Zymo Research

The D4013 is a laboratory instrument designed for the purification and extraction of nucleic acids, such as DNA and RNA, from a variety of biological samples. It utilizes a magnetic bead-based technology to efficiently capture and isolate the target molecules, providing a reliable and consistent method for nucleic acid preparation.

Automatically generated - may contain errors

Lab products found in correlation

P3 primary cell 4d nucleofector x kit l, by Lonza (1 mentions) Steponeplus real time pcr machine, by Thermo Fisher Scientific (1 mentions) Primescript rt, by Takara Bio (1 mentions) Tb green premix, by Takara Bio (1 mentions) Superscript 3, by Thermo Fisher Scientific (1 mentions) Vswp02500, by Merck Group (1 mentions)

3 protocols using d4013

Clonal Cell Expansion and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Selected clonal cells were diluted to have a final concertation of 1 cell/well, seeded into 96-well plates, and allowed to grow for 2 weeks, or until the appearance of rounded colonies. Single colonies were harvested using trypsin and DNA was extracted using QuickExtract (Lucigen #QE09050) buffer. Extracted DNA was then prepped for sequencing. PCR amplicons containing sequence flanking Thr55 were purified using DNA clean & concentrator (Zymo #D4013) and Sanger sequenced. Primer set used to amplify sequence flanking Thr55 are:

FOR 5′ – GCAGTCAGATCCTAGCGTCG

REV 5′ - TACGGCCAGGCATTGAAGT

Edmondson C., Zhou Q, & Liu X. (2021). Analysis of conventional and alternative CRISPR/Cas9 genome editing to enhance a single-base pair knock-in mutation. BMC Biotechnology, 21, 45.

+ Open protocol

+ Expand

Lineage-Specific Knockdown of Transposable Elements

Check if the same lab product or an alternative is used in the 5 most similar protocols

MLTR18C_MM, RLTR1B and a part of LINE1 were synthesized by and cloned in pCCAGGs-IRES-Puro (gift from the Jenuwein laboratory). Clones containing the sense or antisense sequences were verified by sequencing. Lineage⁻ cells (4 × 10⁶) were electroporated with 2 µg of sense and 2 µg of antisense constructs using P3 Primary Cell 4D-NucleofectorTM XKitL (V4XP-3024, Lonza). pCCAGGs-IRES-Puro was used as an EV and pmaxGFP plasmid as transfection efficiency control. Then, 24 h after electroporation, HSCs (LSK/SLAM) were stained and fixed for cell cycle analysis or sorted and total RNA was isolated (D4013, Zymo) and reverse-transcribed using SuperScript III (18080-051, Invitrogen) or PrimeScript RT (RR047A, Takara). RT–qPCR reactions were performed using the TB Green Premix (RR42LR, Takara) in a StepOnePlus Real-Time PCR machine (Applied Biosystems). Expression was quantified over EV and normalized to the expression of HPRT or beta actin.

Clapes T., Polyzou A., Prater P., S.a.g.a.r., Morales-Hernández A., Ferrarini M.G., Kehrer N., Lefkopoulos S., Bergo V., Hummel B., Obier N., Maticzka D., Bridgeman A., Herman J.S., Ilik I., Klaeylé L., Rehwinkel J., McKinney-Freeman S., Backofen R., Akhtar A., Cabezas-Wallscheid N., Sawarkar R., Rebollo R., Grün D, & Trompouki E. (2021). Chemotherapy-induced transposable elements activate MDA5 to enhance haematopoietic regeneration. Nature Cell Biology, 23(7), 704-717.

+ Open protocol

+ Expand

Yeast Display Library Construction for SARS-CoV-2 RBD

Check if the same lab product or an alternative is used in the 5 most similar protocols

For libraries 2C and 2CE, synthetic single-stranded oligonucleotides (ssODNs) (Integrated DNA Technologies ultramers or oPools) were designed with degenerate codons spanning the region of interest and encoding the desired library diversity, with 30 bp overhangs on each end that were homologous to the yeast display plasmid pYD1. For library 2T, pools of ssODN were designed, where each member of the pool contains one combination of the three 'NNK' codons; in this case, consisting of 120 unique ssODNs. The ssODNs were amplified by PCR to produce doublestranded DNA. The plasmid pYD1 was modified such that the entire C-terminal fusion to Aga2 was replaced with a cassette encoding the RBD (Wu-Hu-1 sequence), expression tags and stop codon (HA Tag-RBD-FLAG-Stop). The RBM-2 residues 484-505 were replaced with an EcoRI recognition site, allowing production of a linearized vector with homology to mutagenesis ssODNs and with no parental background. Insert and EcoRI-linearized plasmids were concentrated and purified by silica spin columns (Zymo D4013) followed by drop dialysis for 1 hour in nuclease-free H2O (Millipore VSWP02500). The libraries were cloned and expressed in yeast by in vivo homologous recombination, as previously described (3, 4) , using 1 μg each of plasmid and insert DNA per 300 μl of electrocompetent EBY100 cells in a 2 mm electroporation cuvette.

Taft J.M., Weber C.R., Gao B., Ehling R.A., Han J., Frei L., Metcalfe S.W., Yermanos A., Kelton W., & Reddy S.T. (2021). Predictive profiling of SARS-CoV-2 variants by deep mutational learning.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!