Schneider s media

Ovaries from well-fed females were dissected in Schneider’s media (Genesee Scientific). Tissue was fixed for 15 minutes using 4% EM grade formaldehyde (Polysciences) diluted in PBS or PBS +0.1% Triton X-100 (PBT). Ovaries were washed in PBS + 0.1–0.3% Triton X-100 and stained with DAPI (1:500, 1 mg/mL stock, D3571 ThermoFisher Scientific), phalloidin (1:500, TRITC or FITC conjugated, ECM Biosciences), and one of the antibodies diluted in PBS + 0.3% Triton X-100 + 5 mg/mL BSA. The following antibodies were used in this study: Hts-RC (1:20, htsRC, DSHB), GFP (1:10, 12A6, DSHB), Kelch (1:10, kel1B, DSHB), anti-HA (1:200, Cat. #71-5500, ThermoFisher Scientific), DE-Cadherin (1:20, DCAD2, DSHB), β-catenin pTyr142 (1:200, CP1081, ECM Biosciences), FasIII (1:20, 7G10, DSHB), and phospho-Tyrosine clone 27B10 (1:300, APY03, Cytoskeleton). Secondary antibodies conjugated to Alexa Fluor 488/FITC or Alexa Fluor 555/TRITC (donkey anti-rabbit and donkey anti-mouse from ThermoFisher Scientific, goat anti-rat from Jackson ImmunoResearch) were used at a 1:200 dilution in PBS + 0.3% Triton X-100 + 5 mg/mL BSA. Stained ovaries were mounted using SlowFade Antifade (ThermoFisher Scientific).

Ovaries from well-fed female flies were dissected in Schneider s media (Genesee Scientific). Total RNA was extracted using the RNeasy Plus Mini kit (Qiagen). RNA was reverse transcribed into cDNA and used for qPCR using the QuantiNova SYBR Green RT-PCR kit (Qiagen). The following primer pairs were used: Misshapen- 5′-TCCCTTGGACAGCAGCGATT-3′ and 5′ – AGTTCCATCGTTCCTAGCC – 3′. The primers for the control, GAPDH – 5′ – AAATCGCGGAGCCAAGTAGT - 3′ and 5′ – CACGATTTTCGCTATGGCCG – 3′ were from (Giuliani et al., 2014 (link)). The data in Fig. S1A represents the average of 4 independent experiments. Each reaction was done in triplicate for each experiment, and the Msn expression levels were calculated using the 2^−ΔCq method as described in (Livak and Schmittgen, 2001 (link)). ΔCq was the difference in the Cq values for the GAPDH and the Msn reactions.

Female flies of indicated genotypes were incubated with fresh ground yeast in the presence of males at 18°-29°C for 24-72 hours as indicated in Table S1. After incubation, ovaries were dissected in Schneider’s media (Genesee Scientific) and fixed in 4% EM grade formaldehyde (Polysciences), which was diluted in either PBS or PBS + 0.1% Triton X-100 (PBT) for 15 minutes. Tissue was washed in PBT and PBT3 (PBS+0.3% Triton X-100) and stained with DAPI (1:500, 1 mg/mL stock, D3571 ThermoFisher Scientific), TRITC- or FITC-conjugated phalloidin (1:500, ECM Biosciences), and an antibody targeting Hts-RC diluted in PBT3 + 5 mg/mL BSA. The HtsRC antibody (1:20, hts RC) was obtained from the Developmental Studies Hybridoma Bank (DSHB). Secondary antibodies were conjugated to Alexa Fluor 488/DyLight 488 or Alexa Fluor 555 (donkey anti-mouse or goat anti-mouse from Invitrogen or Jackson ImmunoResearch); they were diluted 1: 100-1:200 in PBT3 + 5mg/mL BSA. SlowFade Antifade (ThermoFisher Scientific) was used to mount tissue on slides.