Escherichia coli topoisomerase I was obtained from New England Biolabs (Ipswich, MA). Calf thymus topoisomerase I and pBR322 plasmid were provided by Takara Bio Inc. (Shiga, Japan). All the buffers and solutions are prepared by the biological purity water. All the ODNs were purchased from Sigma-Aldrich, which were used as topoisomerase inhibitors here. The sequence of single-stranded ODN (ssODN-1) with 50-mer is 5′ CAACAGCGGTAAGTAGAGCTGGTATTGCACAACATGGATCATGTAACTCG 3′. The double-stranded ODN was prepared by heating the single-stranded ODN (ssODN-1) and its complimentary strand (ssODN-2) in a solution containing 10 mM Tris-HCl (pH = 7.8), 50 mM NaCl, and 1 mM EDTA for 5 minutes at 95°C. The resulting mixture was slowly cooled to room temperature.
Calf thymus topoisomerase 1
Manufactured by Takara Bio
Sourced in Japan
Calf thymus topoisomerase I is an enzyme that catalyzes the relaxation of supercoiled DNA. It is involved in various cellular processes such as transcription, replication, and recombination.
Automatically generated - may contain errors
Lab products found in correlation
Escherichia coli topoisomerase 1, by New England Biolabs (1 mentions)
Sybr safe, by Thermo Fisher Scientific (1 mentions)
E coli topoisomerase 1, by New England Biolabs (1 mentions)
Proteinase k, by Thermo Fisher Scientific (1 mentions)
Chemidoc mp system, by Bio-Rad (1 mentions)
Sybr gold staining, by Thermo Fisher Scientific (1 mentions)
3 protocols using calf thymus topoisomerase 1
1
Topoisomerase-Mediated DNA Relaxation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
Escherichia coli topoisomerase I was obtained from New England Biolabs (Ipswich, MA). Calf thymus topoisomerase I and pBR322 plasmid were provided by Takara Bio Inc. (Shiga, Japan). All the buffers and solutions are prepared by the biological purity water. All the ODNs were purchased from Sigma-Aldrich, which were used as topoisomerase inhibitors here. The sequence of single-stranded ODN (ssODN-1) with 50-mer is 5′ CAACAGCGGTAAGTAGAGCTGGTATTGCACAACATGGATCATGTAACTCG 3′. The double-stranded ODN was prepared by heating the single-stranded ODN (ssODN-1) and its complimentary strand (ssODN-2) in a solution containing 10 mM Tris-HCl (pH = 7.8), 50 mM NaCl, and 1 mM EDTA for 5 minutes at 95°C. The resulting mixture was slowly cooled to room temperature.
+ Expand
Escherichia coli topoisomerase I was obtained from New England Biolabs (Ipswich, MA). Calf thymus topoisomerase I and pBR322 plasmid were provided by Takara Bio Inc. (Shiga, Japan). All the buffers and solutions are prepared by the biological purity water. All the ODNs were purchased from Sigma-Aldrich, which were used as topoisomerase inhibitors here. The sequence of single-stranded ODN (ssODN-1) with 50-mer is 5′ CAACAGCGGTAAGTAGAGCTGGTATTGCACAACATGGATCATGTAACTCG 3′. The double-stranded ODN was prepared by heating the single-stranded ODN (ssODN-1) and its complimentary strand (ssODN-2) in a solution containing 10 mM Tris-HCl (pH = 7.8), 50 mM NaCl, and 1 mM EDTA for 5 minutes at 95°C. The resulting mixture was slowly cooled to room temperature.
2
DNA Supercoiling Assay with HU Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA supercoiling assays were performed as described by Guo and Adhya (2007) (link). Briefly, plasmid pCX eGFP was relaxed with E. coli topoisomerase I (New England Biolabs) according to manufacturer’s instructions. Then, 100 ng of relaxed DNA was prepared in 1× topoisomerase buffer (TaKaRa Bio), 0.01% BSA and incubated with 0.5 μg of HUβ2 or HUβ(K86ac)2 in a 10 μL reaction. The reaction was incubated at 37°C for 30 min. Then, 7 units of calf thymus topoisomerase I (TaKaRa Bio) was added to each reaction and the reactions incubated at 37°C for 2 h. 10 μg of proteinase K (Invitrogen) was added to each reaction, which were incubated at 37°C for 30 min. Then, 5× DNA loading dye (Qiagen, #239901) was added to each reaction and the samples were analyzed on 0.8% agarose in 1× TBE buffer and electrophoresed at 150 V for 90 min. Post-run, the gel was stained with SybrSafe (Invitrogen) according to manufacturer’s instructions and imaged on a Bio-Rad ChemiDoc MP system.
3
Chromatin Assembly Reconstitution Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The purified H2A-H2B dimer or H2A-H2B E76K dimer (1.5, 3 and 4.5 pmol) and H3.1-H4 tetramer (0.75, 1.5 and 2.25 pmol) were incubated with 11.25 pmol of human Nap1 at 37°C for 15 min, in 3.7 μl of reaction solution. The pBluescript plasmid DNA containing eleven 5S repeats (5276 bp, 29 fmol), which was previously incubated with 1.7 units of calf thymus topoisomerase I (Takara) at 37°C for 60 min, was then added to the reaction mixture. The reactions were continued at 37°C for 60 min in 11 mM Tris–HCl buffer (pH 7.5), containing 84 mM NaCl, 0.43 mM MgCl2, 1.2 mM DTT, 0.73 mM EDTA, 1.4 mM 2-mercaptoethanol, 0.01 mM phenylmethylsulfonyl fluoride (PMSF) 0 and 1% glycerol (total volume: 4.7 μl). The reaction solutions were incubated with 2 μl of a proteinase K solution (1.67% sodium dodecyl sulphate (SDS) and 9.3 mg/ml proteinase K) for 15 min at room temperature, and the reactions were terminated. The DNA samples were then analyzed by 1% agarose gel electrophoresis in 1× Tris-acetate-EDTA (TAE) buffer, and were visualized by SYBR Gold staining (Invitrogen).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!