Ab290

Heads were isolated from ~ 1000 Drosophila, per genotype, pan-neuronally expressing either UAS-AP1000, UAS-GA1000, UAS-PR1000, UAS-GR1000 or UAS-mCD8-GFP under the control of nSyb-Gal4. Wild type controls were Canton-S outcrossed to w¹¹¹⁸. Heads were lysed in RIPA buffer (10 mM Tris–Cl pH 8.0, 1 mM EDTA, 0.5 mM EGTA, 1% Triton X-100, 0.1% Sodium deoxycholate, 0.1%SDS, 140 mM NaCl), lysate cleared via centrifugation and filtration through 0.45 μm filters and diluted to 4 mg/ml. Lysates were incubated with pre-washed ChromoTek GFP-Trap^® magnetic affinity beads (30 μl, overnight 4 °C). Beads were then washed and protein eluted in 4x laemmli buffer. Samples were diluted to 1 × and run on 4–15% Mini-PROTEAN ^® TGX™ Precast Gels. Transfers were performed overnight (25 V, 0.02% SDS, 10% Methanol, Immobilon-P .45 μm PVDF). Primary antibodies were anti-GFP (rabbit, abcam, ab290, rabbit, abcam, ab290, preabsorbed against Drosophila embryos, RRID:AB_303395) and anti-GR repeat (rabbit Proteintech, 23978-1-AP). Secondary antibodies were HRP conjugated anti-rabbit IgG (Goat, Stratech,111-035-045-JIR). Blots were imaged using a G:box imaging unit (syngene).

HeLa cells were grown on minimal essential medium containing 10% newborn calf serum. HSV-1 wild type strain KOS, null mutant 27-LacZ, N-YFP-tagged ICP27 (N-YFP-ICP27) and n504 were previously described31 (link). Cells were infected with wild-type or mutant virus as indicated for 8 hours at a multiplicity of infection (MOI) of 10 for single infections and a MOI of 5 for co-infections and incubated at 37 °C. Transfection of plasmid DNA was performed by using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocol. Transfected cells were infected 24 hours after transfection with 27-LacZ to stimulate expression of the native ICP27 promoter by the virion tegument protein VP16 as previously described58 (link). Eight hours after infection, cells were harvested, and immunoprecipitation was performed on cell lysates using GFP/YFP antibody Ab290 (Abcam) as described previously6 (link). Immunoprecipitated complexes were separated by SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose. Western blot analysis was performed as described previously6 (link) with anti-ICP27 antibodies P1119 and P1113 (Virusys), anti-GFP/YFP (Ab290; Abcam), anti-GFP antibody Ab1218 (Abcam) and Lamin B1 (Abcam).

U2OS cells were transfected with AURKA-Venus WT or mutant and seeded onto coverslips. After 24 h, cells were fixed with ice-cold methanol (IF) or 4% PFA (isPLA). Cells were processed for IF using primary antibodies against GFP (rabbit polyclonal, ab290; Abcam) and β-tubulin (mouse mAb, T4026; Sigma-Aldrich) and secondary antibodies anti-mouse Alexa Fluor 488 and anti-rabbit Alexa Fluor 568 (Thermo Fisher Scientific). Cells were processed for isPLA using Duolink In Situ Detection Orange (Sigma-Aldrich) according to the manufacturer’s instructions, using primary antibodies against GFP (mouse mAb, clone #11814460001; Roche) and TPX2 (rabbit polyclonal antibody; Novus Biological). Epifluorescence images were acquired on the widefield imaging platform described above, as stacks of 500-nm step with 2 × 2 bin, using appropriate filter sets and 40× NA 1.3 oil objective, and exported as maximal intensity projections in ImageJ (http://rsb.info.nih.gov/ij/; National Institutes of Health).

The LeGO‐V2 (Venus) vector was previously described 12 and kindly provided by Kristoffer Weber and Boris Fehse. Lentiviral particles were generated as previously described 13. For transduction, human basal PESCs were cultured for 24 hrs at a fixed cell number. Target cells were incubated in the presence of 8 μg/ml polybrene for 12 hrs at 37°C with viral supernatant at a multiplicity of infection of 50–60 per vector. Transduction efficiency was validated 48–72 hrs after transduction using FACS. To prove in vivo stem cell capability of our culture‐derived cells, we coinjected LeGO‐V2 marked cultured human basal PESCs together with E16 UGSM and Matrigel into male nude mice subcutaneously. To support differentiation, we subcutaneously implanted testosterone pellets (12.5 mg/90‐day release; Innovative Research of America). After 10–12 weeks, we harvested the regenerated s.c. grafts for subsequent analyses. Before conducting histological analyses on fixed tissue, we validated direct Venus fluorescence in freshly dissected s.c. grafts under the fluorescence stereomicroscope. Detection of Venus+ in regenerated prostate tissue (proof of regeneration from transplanted PESCs origin) was done by staining s.c. grafts with a monoclonal antibody against GFP/Venus (ab 290; Abcam, Cambridge, UK) 11.

ChIP was performed as previously described^{59 (link)}. 100 mL log phase cells were fixed with 1% formaldehyde (F8775, Sigma, USA) for 30 mins at room temperature. The cell wall was digested with Zymolase 20 T at 30 °C for 30 mins. Cell lysates were incubated with anti-GFP antibody (ab290, Abcam, UK) and Protein A agarose beads (223-50-00, KPL, USA). The precipitated DNA was suspended in 20 μl TE buffer. 2 μl of ChIP or WCE (whole cell extract) samples were analyzed by qPCR (4367659, Applied Biosystems, USA) with primers specific to the mating type region (mal-F: GAAAACACATCGTTGTCTTCAGAG; mal-R: TCGTCTTGTAGCTGCATGTGA), sub-telomere region (jk380: TATTTCTTTATTCAACTTACCGCACTTC; jk381: CAGTAGTGCAGTGTATTA TGATAATTAAAATGG), and the control gene, act1 + (Act1: ATGGAAGAAGAAATCGCAGCG; Act2: GATGCCAAATCTTTTCCATATC).

Humeral head and supraspinatus tendon composite were harvested and fixed in the 4% paraformaldehyde in PBS overnight at room temperature. After decalcified and dehydrated, samples were embedded in Tissue-Tek O.C.T. Compound (SAKURA, Torrance, USA) and cut into 10 μm thickness of sagittal sections. Cell samples were fixed in the 4% paraformaldehyde in PBS for 30 min at room temperature. Both the parts and cell samples were blocked in 5% BSA for 40 min at room temperature and incubated with the primary antibodies anti-DMP1 (Abcam, 1:400, ab13970), anti-GFP (Abcam, 1:400, ab13970 or 1:400, ab290), anti-Sox9 (Abcam, 1:400; ab185966), anti-TGF-βR2 (Abcam, 1:400, ab186838) at 4 °C overnight. After washing, the sections were then incubated with the respective secondary antibodies (1:500, Abcam) for 1 hr at room temperature and sealed with DAPI. The images were captured with a Leica TCS-SP8 confocal microscope (Leica, Germany).