Sybr green pcr kit
The SYBR Green PCR kit is a reagent system designed for real-time polymerase chain reaction (PCR) analysis. It contains a DNA-binding dye, SYBR Green I, which exhibits fluorescence upon binding to double-stranded DNA. This allows for the monitoring and quantification of DNA amplification during the PCR process.
Lab products found in correlation
14 protocols using sybr green pcr kit
Liver Gene Expression Analysis
RNA Extraction and RT-qPCR Analysis
Characterization of Circular RNA in PDAC
Gene Expression Analysis of Cellular Markers
Quantitative gene expression analysis
Quantification of miR-20b-5p Expression
Gene Expression Analysis by qRT-PCR
Quantifying Neuroinflammatory Markers in Hippocampus
Hippocampal samples were homogenized in a tenfold volume of RIPA lysis buffer. The supernatant was then obtained by centrifuging the homogenates at 4°C and 12,000 g for 15 min. Finally, the level of TNF-α (Bioswamp, MU30030), IL-6 (Bioswamp, MU30044) and IL-1β (Bioswamp, MU30369) in supernatant was measured by ELISA analysis.
Gene Expression Analysis of Osteoblast Markers
Quantitative Analysis of VKORC1 Expression
VKORC1: F, GAGCCTGATGTGGCTCAGTT
R, TCAGTGCCTCTTAGCCTTGC
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!