Reverse transcriptase

The above RNA samples were also used for synthesis of first-strand cDNA with reverse transcriptase (BIO-RAD, Hercules, CA, USA), and the cDNAs were used for quantitative real-time PCR using a CFX96™ Real Time System (BIO-RAD) as previously described (Shi et al., 2013c). The specific primers of the analysed genes for real-time PCR are listed in Supplementary Table S1 available at JXB online, and the housekeeping genes have been described in Hu et al. (2012) .

Total RNA from cultured astrocytes were prepared using the RNeasy Mini Kit (Qiagen, Valencia, CA) with on-column DNase digestion. RNA was quantified using a Nanodrop system (Thermo Scientific, Wilmington, DE), with the average yield of RNA from 75–100 ng/μL. Whole brain total RNA was prepared with the Qiagen RNeasy Mini Kit and used for a positive control. cDNA was synthesized using reverse transcriptase (BioRad, Hercules, California) and reverse transcriptase-PCR was conducted. PCR products were visualized with a 1.5% agarose gel with ethidium bromide staining on a BioRad Chemidoc XRS imager. Primers used are listed in Table S1.

Total RNA, after lysis of cells in QIAzol lysis reagent (Qiagen), was purified using phenol-chloroform extraction. cDNA was synthetized using reverse transcriptase from Bio-Rad Laboratories. The amount of specific transcripts was measured by qRT-PCR using QuantiTect SYBR-Green PCR kit (Bio-Rad Laboratories) in the presence of specific primers synthesized by PRIMM (Table I) through the DNA Engine Opticon Real-Time PCR detection system (Bio-Rad Laboratories); each assay was run in triplicate. The relative amount of specific transcripts was calculated by the comparative cycle threshold method (27 (link)). The amount of GAPDH and β-actin transcripts was measured to normalize specific RNA levels.
The mRNA half-live was calculated by the equation (t_1/2=Ln(0.5)/slope). The oligonucleotides used for DRB mRNA quantification were primers common to all DRB1 alleles (7 (link)).

Total RNA was extracted from PBMC cells isolated from whole blood using Macherey‐Nagel, Germany. The total RNA concentration was measured by a NanoDrop® ND1000 (Thermo Fisher Scientific Inc., Waltham, MA, USA) at 260 nm and 280 nm (A260/A280 ratio). Reverse transcription of total RNA (500 ng per sample) was done by reverse transcriptase (Bio‐Rad, Hercules, CA, USA), as reported by the manufacturer's procedure. qPCR reactions were accomplished via TaqMan Universal PCR Master Mix (Applied Biosystems, Foster, CA, USA), consistent with the manufacturer's procedure. “Primer pairs used in the study were: ‐Actin‐F: 5 ‐CTGGAAC GGTGAAGGTGACA‐3; ‐Actin‐R: 5 ‐AAGGGACTT CCTG TAACAATGCA‐3; CB1‐F: 5‐CAGAAGAGCATCATCCACACGTCTG‐3; CB1‐R: 5‐ATGCTGTTATCCAGAGG CTGCG CAG TGC‐3; CB2‐F: 5 ‐TTTCCCACTGATCCCCAATG‐3; CB2‐R: 5 ‐AGTTGATGAGGCACAGCATG‐3 (Rotter et al., 2013 (link))”. Reactions were done on a Real‐Time PCR Cycler IQ (Bio‐Rad, Hercules, CA, USA) with version 3.0 of the software. Cycle threshold values (Ct) were calculated automatically. Expression of the β‐actin transcript (housekeeping gene) was measured to control for variation in cDNA amounts. The abundance of RNA was calculated as Relative Expression = 2^−ΔΔC (Smith et al., 2004 (link)), shown as fold change in Figure 2.