Superscript first strand synthesis system

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany, China, United Kingdom, Japan

The SuperScript First-Strand Synthesis System is a laboratory kit designed for the reverse transcription of RNA into complementary DNA (cDNA). The system provides a set of reagents and protocols to efficiently convert RNA into single-stranded cDNA, which can then be used for various downstream applications, such as PCR amplification, gene expression analysis, and library construction.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

First-Strand Synthesis System (55 citations)

897 protocols using superscript first strand synthesis system

Extraction and Reverse Transcription of Gingival RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

The patient’s gingiva was obtained and stored in RNAlater (Thermo Fisher Scientific, Waltham, MA, United States), and total RNA was extracted using TRIzol^® reagent (Life Technologies, Carlsbad, CA, United States) according to the manufacturer’s instructions. Next, 100–1,000 ng of total RNA was reverse-transcribed using the Superscript First-Strand Synthesis System (Life Technologies, Carlsbad, CA, United States) (Zeng et al., 2018 (link)). Primers were designed using the Primer 3 software [http://primer3.ut.ee/(1 June 2020); primer sequences are shown in Supplementary Table S1]. The exon 10–12 fragment of LAMB3 cDNA was amplified, and the PCR product was sequenced by Tsingke Biological.

Li F., Yu M., Fan Z., Wu J., Tian H., Feng H., Liu Y., Liu H, & Han D. (2022). Rare compound heterozygous variants of LAMB3 and histological features of enamel and oral mucosa. Frontiers in Physiology, 13, 1006980.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from DLBCL cell lines and primary mouse lymphocytes by TRIzol (Life Technologies) and treated with DNAse prior to cDNA synthesis, which was performed using the SuperScript® First-Strand Synthesis System (Life Technologies), according to the manufacturer's instructions. The ABsolute QPCR SYBR green mix (Thermo Scientific) was then utilized to amplify specific cDNA fragments with the oligonucleotides listed below, in the 7300 Real Time PCR system (Applied Biosystems). Data were analyzed by the change-in-threshold (2^−ΔΔCT) method^{62 (link)}, using Actin as housekeeping reference gene.

Zhang J., Dominguez-Sola D., Hussein S., Lee J.E., Holmes A.B., Bansal M., Vlasevska S., Mo T., Tang H., Basso K., Ge K., Dalla-Favera R, & Pasqualucci L. (2015). Disruption of KMT2D perturbs germinal center B cell development and promotes lymphomagenesis. Nature medicine, 21(10), 1190-1198.

+ Open protocol

+ Expand

Quantitative PCR Protocol for Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using RNeasy Mini kit (QIAGEN). Further DNA removal was performed with the RNase-Free DNase Set (QIAGEN). First-strand complementary DNA (cDNA) was synthesized with oligo dT or random hexamers as primers, using SuperScript First-Strand Synthesis System according to manufacturer’s protocol (Life Technologies). An equal volume mixture of the products was used as templates for PCR amplification. Reactions were performed in a 25 μl volume with iQ™ SYBR Green Supermix (Bio-Rad) and 200 nM each of forward and reverse primers shown in Supplementary Table 3 using iCyler and iQ software (Bio-Rad). Each sample was run in triplicate. PCR conditions included an initial denaturation step of 4 min at 95°C, followed by 40 cycles of PCR consisting of 30 s at 95°C, 30 s at 60°C, and 30 s at 72°C. Average threshold cycle (Ct) values from the triplicate PCR reactions for a gene of interest were normalized against the average Ct values for GAPDH from the same cDNA sample.

Jiang H., Xu Z., Zhong P., Ren Y., Liang G., Schilling H.A., Hu Z., Zhang Y., Wang X., Chen S., Yan Z, & Feng J. (2015). Cell cycle and p53 gate the direct conversion of human fibroblasts to dopaminergic neurons. Nature Communications, 6, 10100.

+ Open protocol

+ Expand

Quantification of NRG1 Isoforms in Chick Spinal Cord

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

5- to 6-somite segments of lumbar spinal cords were harvested from unilateral limb ablated chick embryos at E6 and then separated for RNA extraction. Total RNA from both tissue and cell cultures were isolated using RNeasy mini kit (Qiagen). Equal amounts of total RNAs were reverse transcribed using oligo(dT) by Superscript First-Strand Synthesis System (Life Technologies). Chick IG-NRG1 and CRD-NRG1 transcripts were detected as previously described (Ma et al., 2011 (link)). Rat type I and type II NRG1 were measured by Rn00580917_m1 and Rn01482172_m1, respectively; type III NRG1 were detected by: forward primer, 5′-TCCTAAACTTTCCACATCGACATC; reverse primer, 5′-TCTCATAAAGTGCGCGGAG; and taqman probe, 6FAM-ACGACTGGGACCAGC. Rat GAPDH was detected by Rn99999916_s1 for normalization (Life Technologies). Message levels of NRG1 isoforms were normalized to GAPDH. qPCR data were collected from at least three biological replicates, and ΔΔCt was used for calculations.

Wang J., Hmadcha A., Zakarian V., Song F, & Loeb J.A. (2015). Rapid transient isoform-specific neuregulin1 transcription in motor neurons is regulated by neurotrophic factors and axon-target interactions. Molecular and cellular neurosciences, 68, 73-81.

+ Open protocol

+ Expand

Ischemic Hemisphere Transcriptome Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ischaemic cerebral hemisphere was removed from deeply anaesthetised rats at 24 h after reperfusion. Total RNA was extracted by using Trizol (Invirtogen) and reverse transcribed into cDNA with a Superscript First-Strand Synthesis System (Life Technologies, Grand Island, NY). Quantitative analysis was performed by using SYBR Green real-time PCR master mix (Life Technologies). GAPDH was used as the internal control in this study. The PCR primer sequences are listed in Table 1.

Zhang X., Zhang Q., Huang L., Liu M., Cheng Z., Zheng Y., Xu W., Lu J., Liu J, & Huang M. (2021). Pien-Tze-Huang attenuates neuroinflammation in cerebral ischaemia-reperfusion injury in rats through the TLR4/NF-κB/MAPK pathway. Pharmaceutical Biology, 59(1), 826-837.

+ Open protocol

+ Expand

Quantifying Ep300 mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from sorted murine GC B cells using the
NucleoSpin XS kit (Marchery-Nagel), and from SUDHL4 cells exposed for 48hrs
to DMSO (0.1%), CCS1477 (1 μM), or CU329 (0.1 μM) using the
TRIzol reagent (Invitrogen), as per manufacturer’s instructions. cDNA
synthesis was performed using the SuperScript® First-Strand Synthesis
System (Life Technologies). Oligonucleotides annealing to exon 8
(AGTGAAAATGCTGGTGTGGC) and exon 11 (TAGACGGGTCAGGTACAGGA) of the murine
Ep300 locus were used to determine the relative
abundance of the Ep300 mRNA before and after Cre-mediated recombination (see
Figure
S1A).

Meyer S.N., Scuoppo C., Vlasevska S., Bal E., Holmes A.B., Holloman M., Garcia-Ibanez L., Nataraj S., Duval R., Vantrimpont T., Basso K., Brooks N., Dalla-Favera R, & Pasqualucci L. (2019). Unique and Shared Epigenetic Programs of the CREBBP and EP300 Acetyltransferases in Germinal Center B Cells Reveal Targetable Dependencies in Lymphoma. Immunity, 51(3), 535-547.e9.

+ Open protocol

+ Expand

RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Manually separated heads were ground in liquid nitrogen, and total RNA was extracted using the TRIZOL reagent (life technologies, Carlsbad, USA). Messenger RNA was purified with the Dynabeads purification kit (life technologies, Carlsbad, USA) and cDNA was synthesized using the Super-Script first-strand synthesis system (life technologies, Carlsbad, USA). Hotstart Taq DNA polymerase (Qiagen, Venlo, Netherlands) was used to amplify individual transcripts. Finally the products were cloned into PCR2.1 vector (life technologies, Carlsbad, USA) and verified by sequencing. Most primers were designed to bind within the UTRs to not bias start and stop codons and are summarized in Additional file 1: Table S1.

Dippel S., Oberhofer G., Kahnt J., Gerischer L., Opitz L., Schachtner J., Stanke M., Schütz S., Wimmer E.A, & Angeli S. (2014). Tissue-specific transcriptomics, chromosomal localization, and phylogeny of chemosensory and odorant binding proteins from the red flour beetle Tribolium castaneum reveal subgroup specificities for olfaction or more general functions. BMC Genomics, 15, 1141.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from cells was isolated using TRIzol reagent (Invitrogen) and quantified spectrophotometrically. Single-stranded cDNA was synthesized using SuperScript First-Strand Synthesis System (Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. Sequences of all primers used are listed in Table I. All real-time PCR reactions were performed with SYBR-Green Master Mix kit (all-in-One™ qPCR SYBR-Green I Mix from GeneCopoeia, Rockville, MD, USA) using an ABI PRISM 7500 sequence detection system. GADPH was used as an internal loading control. The reactions were performed as follows: denaturation for 10 min at 95°C, 40 cycles of 95°C for 10 sec, and 60°C for 20 sec. The 2^−ΔΔCt method was performed to calculate the relative mRNA expression of target genes.

WANG J., HU W., WANG K., YU J., LUO B., LUO G., WANG W., WANG H., LI J, & WEN J. (2016). Repertaxin, an inhibitor of the chemokine receptors CXCR1 and CXCR2, inhibits malignant behavior of human gastric cancer MKN45 cells in vitro and in vivo and enhances efficacy of 5-fluorouracil. International Journal of Oncology, 48(4), 1341-1352.

+ Open protocol

+ Expand

Quantifying Granulocyte-Macrophage Colony-Stimulating Factor Receptor Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the TRIzol reagent (Life Technologies, Grand Island, NY) and cDNA was synthesized using the SuperScript First-Strand Synthesis System (Life Technologies). Human GM-CSFRα and GM-CSFRβ primers were obtained from Applied Biosystems (Life Technologies). The cell lines OCI/AML3, OCI-2, K562, and Jurkat were used as positive and negative controls. To amplify GM-CSFRα transcripts a regular PCR program was performed with 30 cycles, and to amplify GM-CSFRβ transcripts a 50 cycle touchdown program was executed.

Li P., Harris D., Liu Z., Rozovski U., Ferrajoli A., Wang Y., Bueso-Ramos C., Hazan-Halevy I., Grgurevic S., Wierda W., Burger J., O'Brien S., Faderl S., Keating M, & Estrov Z. (2014). STAT3-Activated GM-CSFRα Translocates to the Nucleus and Protects CLL Cells from Apoptosis. Molecular cancer research : MCR, 12(9), 1267-1282.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using RNeasy Mini kit (Qiagen). Further DNA removal was performed with the RNase-Free DNase Set (Qiagen). First-strand cDNA was synthesized with oligo dT or random hexamers as primers, using SuperScript First-Strand Synthesis System according to the manufacturer's protocol (Life Technologies). An equal volume mixture of the products was used as templates for PCR amplification. Reactions were performed in a 25-μl volume with iQ SYBR Green Supermix (Bio-Rad) and 200 nM each of forward and reverse primers shown in Supplementary Table 3 using iCyler and iQ software (Bio-Rad). Each sample was run in triplicate. PCR conditions included an initial denaturation step of 4 min at 95°C, followed by 40 cycles of PCR consisting of 30 s at 95 °C, 30 s at 60 °C and 30 s at 72 °C. Average threshold cycle (Ct) values from the triplicate PCR reactions for a gene of interest were normalized against the average Ct values for GAPDH from the same cDNA sample.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!