Cfx96 real time pcr system

Total RNA was extracted from cell lines using Trizol reagent (Invitrogen) according to the manufacturer^’s protocol. Levels of miR-675-5p and miR-200a, b and c were normalized to U6 and levels of ZEB1, UBQLN1 and RB were normalized to GAPDH, respectively to yield a 2^−DDCt value for relative expression of each transcript and a >35 Ct value indicated negative amplification. Experiments were repeated at least three times. The miRNA RT reaction was carried out under the following conditions: at 42°C for 60 min, at 70°C for 10 min. After the RT reaction, the complementary DNA products were diluted at 1:20 and 2ul of the diluted complementary DNA was used for subsequent qRT-PCR reactions. The miR-RNA primers were obtained from RIBOBIO in Guangzhou. Other qRT-PCR primers were listed in Table 1. The qRT-PCR reaction was conducted at 95°C for 20s and followed by 40 cycles of 95°C for 10s, 60°C for 20s and 72°C for 10s in the CFX 96 real-time PCR system (Applied Biosystems, CA, USA). The qRT-PCR results were analyzed and expressed as relative miRNA expression of Ct value, which was then converted to fold changes.

Total RNA was isolated from cells using Trizol (Sigma, Shanghai, China) according to the manufacturer’s instructions. The concentration and quality of RNA samples were measured with a spectrophotometer NanoDrop 2000 (Thermo Fisher, Waltham, MA, USA). Complementary DNA was synthesized using 1 μg RNA with a PrimeScript™ RT reagent Kit (Takara). RT-qPCR reactions were performed using a Real-time PCR Mixture assays kit (TaKaRa, Dalian, China) on a CFX96 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The primer sequences for qRT-PCR reactions were as follows: NORAD forward, 5′-TGATAGGATACATCTTGGACATGGA-3′ and reverse, 5′-AACCTAATGAACAAGTCCTGACATACA-3′; β-actin forward, 5′-AGCACAGAGCCTCGCCTT-3′ and reverse, 5′-CATCATCCATGGTGAGCTGG-3′; miR-30c-5p forward, 5′-AGCGTCGTATCCAGTGCAAT-3′ and reverse, 5′-GTCGTATCCAGTGCGTGTCG-3′; and U6 forward, 5′-CTCGCTTCGGCAGCACA-3′ and reverse, 5′-AACGCTTCACGAATTTGCGT-3′. Conditions were set as follows: 95°C for 30 s, 40 cycles at 95°C for 5 s, annealing, and extension at 60°C for 30 s, and melt curve analysis. U6 was used as an internal control for miR-30c-5p and human β-actin was used as an internal control for mRNA detection. The relative expression levels were calculated using the 2^−ΔΔCt method. Experiments were performed in triplicate.

Total RNA from the wound samples and single cell suspensions was extracted with an RNA extraction kit (AIVD, Guangzhou, China). Then, cDNA synthesis was performed using a PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). The RT-PCR primer sequences were synthesized by Sangon Biotech (Shanghai, China) in Table 1:
Table 1

Primer sequences

Gene Forward primer (5′–> 3′)	Reverse primer (5′–> 3′)
β-actin CGTTGACATCCGTAAAGACC	TAGGAGCCAGAGCAGTAATC
GFP GCACGACTTCTTCAAGTCCGCCATGCC	GCGGATCTTGAAGTTCACCTTGATGCC
LPL AGTTTGACCGCCTTCCGCGG	TCCTGTCACCGTCCATCCATGGA
PPARγ ACTGCCGGATCCACAAAA	TCTCCTTCTCGGCCTGTG
ALP AACCCAGACACAAGCATTCC	CCAGCAAGAAGAAGCCTTTTG
Runx-2 TGCCACCTCTGACTTCTGCC	CGCTCCGGCCCACAATCTC

PCR was conducted on a TaKaRa Real-Time PCR machine using SYBR Green (SYBR® Premix Ex Taq™, TaKaRa, Beijing, China) and validated with a CFX96 Real-Time PCR system (Applied Biosystems). The mRNA expression level of the target gene was normalized to β-actin expression and was analyzed using the comparative method of relative quantification (2^−ΔΔCt). Five repetitions were performed on each sample.

The CFX96 Real-Time PCR system (Applied Biosystems Co., Ltd., Foster City, CA, USA) was used for real time quantitative RT-qPCR analysis performed by SYBR^® Select Master Mix Kit (Applied Biosystems Co., Ltd.). According to the manufacturer’s protocol (Applied Biosystems Co., Ltd., Foster City, CA, USA), expression levels of genes involved in proinflammatory cytokines (IL-6 and TNF-α), lipid metabolism (SIRT1, PPAR, ACC, and CD36), and β-actin (control) were analyzed. The relative expression level of mRNA was measured by PCR system (Applied Biosystems, USA) software represented by the ratio of expression level of target gene to endogenous gene showed in bar graph. The PCR primers used in the experiments was described in our previous publication [12 (link)].

RNA was collected using a PureLink RNA MiniKit (Ambion) and converted to cDNA with the High-Capacity cDNA reverse transcription kit (Applied Biosystems). qPCR was conducted in a Bio-Rad CFX96 real-time PCR system using TaqMan gene-specific primer/probe sets (Applied Biosystems) and SsoAdvanced master mix (Bio-Rad). Analysis was conducted using Bio-Rad CFX Manager software, and message levels were normalized to GAPDH.

RNA was extracted using a TRIzol kit (Takara, Japan). Then, Prime Script^TM RT Master Mix (Takara) was used for cDNA synthesis. Gene expression were quantified by RT-qPCR in a CFX96 real-time PCR system (Applied Biosystems, USA) using the SYBR Premix Ex Taq II kit (Takara) according to the manufacturer’s instructions. GAPDH and U6 were used as normalization controls, and gene expression was calculated using the 2^−ΔΔCt method [13 (link)]. Primer sequences were shown: CRNDE, 5ʹ-CGCGCCCGCGCGGCGGAGGA-3ʹ- (forward), 5ʹ-AGTATGAATTGCAGACTTTGCA-3ʹ- (reverse); miR-146a-5p, 5ʹ-GGGGTGAGAACTGAATTCCAT-3ʹ- (forward), 5ʹ--CAGTGCGTGTCGTGGAGT-3ʹ- (reverse); WNT5A, 5ʹ-AGACGGGCATCAAAGAGT-3ʹ- (forward), 5ʹ-AAGCGGTAGCCATAGTC-3ʹ- (reverse); TNF-α, 5ʹ-CATGATCCGAGATGTGGAACTGGC-3ʹ- (forward), 5ʹ-CTGGCTCAGCCACTCCAGC-3ʹ- (reverse); IL-1β, 5ʹ-GGATAACGAGGCTTATGTGCACG-3ʹ- (forward), 5ʹ-GGACATGGAGAACACCACTTGTT-G-3ʹ- (reverse); IL-6, 5ʹ-GACTGATGTTGTTGACAGCCACTGC-3ʹ- (forward), 5ʹ-AGCCACTCCTTCTGTGACTCTAACT-3ʹ- (reverse); IL-10, 5ʹ--CGGGAAGACAATAACTGCACCC-3ʹ- (forward), 5ʹ-CGGTTAGCAGTATGTTGTCCAGC-3ʹ- (reverse); GAPDH, 5ʹ-CAAGGTCATCCATGACAACTTTG-3ʹ- (forward), 5ʹ-GTCCACCACCCTGTTGCTGTAG-3ʹ- (reverse); U6, 5ʹ-CTCGCTTCGGCAGCACATATACT-3ʹ- (forward), 5ʹ-ACGCTTCACGAATTTGCGTGTC-3ʹ- (reverse).