Potassium ferricyanide k3 fe cn 6

ENaC protein was obtained from Abcam, UK. ENaC aptamer (sequence: 5′–/5Biosg/CGGTGAGGGTCGGGTCCAGTAGGCCTACTGTTGAGTAGTGGGCTCC–3′) was obtained from DT Integrated DNA Technologies, US. Bovine serum albumin (BSA) and potassium ferricyanide (K₃[Fe(CN)₆]) were acquired from Sigma Aldrich. Sodium chloride (NaCl), sodium hydroxide (NaOH), phosphate buffer saline (PBS, pH 7.4) and cerium (III) nitrate hexahydrate (Ce(NO₃)₃ · 6H₂O) were obtained from Merck. The double-distilled water was produced by PT Ikapharmindo Putramas, Indonesia.
Electrochemical measurements were performed by using a ZP potentiostat with the computer Interface of PSTrace 5.4 software (Zimmer & Peacock, UK). The SPCE (GS1 Technologies, USA) consisted of carbon working and counter electrodes as well as an Ag/AgCl reference electrode. In addition, other supporting equipment included an autoclave sterilizer (Hirayama Autoclave HVE-50), microtubes and micropipette tips (Eppendorf), magnetic stirrer, mini spin (Eppendorf), hot plate (IKA C-MAG HS 7) and centrifuge (Thermo Scientific MicroCL 17R, USA). The morphologies of the electrode surface were analysed by using scanning electron microscopy (SEM) (Hitachi, Japan).

BBR, phenacetin, coumarin, bupropion, tolbutamide, dextromethorphan, chlorzoxazone, testosterone (TST), ketoconazole, verapamil, diltiazem, mifepristone, carbamazepine (CBZ), potassium ferricyanide (K₃Fe(CN)₆), glucose 6-phosphate (G6P), glucose 6-phosphate dehydrogenase (G6PDH), β-nicotinamide adenine dinucleotide phosphate hydrate (NADP⁺; oxidized form), nebivolol hydrochloride, formic acid were purchased from Sigma-Aldrich (St. Louis, MO, USA). Midazolam (MDZ) was bought from Bukwang Pharmaceutical Co. (Seoul, Korea). S-Mephenytoin was purchased from BD Gentest Co. (Woburn, MA, USA). BRB chloride, JTZ, tetrahydroberberine (THB; canadine), and β-nicotinamide adenine dinucleotide phosphate (NADPH; reduced form) were supplied by Toronto Research Chemicals Inc. (Toronto, ON, Canada). DMB and TFD chloride were purchased from Inter Pharm (Goyang, Korea) and WuXi AppTec Co. (Shanhai, China), respectively. Tetrahydroberberrubine·acetate (TRB; purity > 95%) was isolated from the fruits of Nandina domestica (see Supplementary Materials). Pooled HLM and recombinant human CYP2D6 (rhCYP2D6; product number: 456217) were obtained from Corning Gentest (Corning, NY, USA) and stored at −80 °C before use. All the other chemicals and reagents used were of analytical grade.

NaCl, p-iodonitrotetrazoliumchloride, lipoxygenase (5-LOX), tyrosinase, 1,1-diphenyl-2-picrylhydrazyl (DPPH), α-tocopherol, potassium ferricyanide K₃Fe(CN)₆, methanol, acid 2,2′-azino-bis (3-éthylbenzothiazoline-6-sulphonique (ABTS), ascorbic acid, trichloroacetic acid (TCA), ferric chloride, β-carotene, chloroform, tween-80, L-DOPA, linoleic acid, ethanol, and quercetin were procured from Sigma-Aldrich. Potato dextrose agar (PDA), luria-Bertani (LB) agar, DMSO, chloramphenicol, vancomycin, and fluconazole were purchased from labKem, Barcelona, Spain and Biokar Diagnostics, Beauvais, France. All used elements were of analytical grade.