Full-length hSpindly (NCBI Gene ID: 54908) and 2581–3210 aa of hCENP-F (NCBI Gene ID: 1063) cDNAs were amplified from a human fetal cDNA library (Spring Bioscience) using gene-specific primers and cloned into the pDONR221 vector (Invitrogen). hSpindly N- and C-terminal truncation constructs (Fig. 1 A ) were amplified using pDONR221 hSpindly as a template using specific primers. Truncation constructs were cloned into the pDONR221 vector (Invitrogen) using attB recombination linkers of the Gateway Technology cloning system (Invitrogen). Cloning into gateway destination pEGFP (CMV promoter) expression vector (Chan et al., 1998 (link)) was performed using the Gateway Technology cloning system.
Pdonr221 vector
Manufactured by Thermo Fisher Scientific
Sourced in United States
The PDONR221 vector is a plasmid vector designed for protein expression in E. coli. It contains a T7 promoter for high-level protein expression, a His-tag sequence for purification, and multiple cloning sites for inserting the gene of interest.
Automatically generated - may contain errors
Lab products found in correlation
Lr clonase 2, by Thermo Fisher Scientific (6 mentions)
Bp clonase, by Thermo Fisher Scientific (5 mentions)
Lr clonase, by Thermo Fisher Scientific (3 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Bp clonase 2, by Thermo Fisher Scientific (3 mentions)
Bp reaction, by Thermo Fisher Scientific (2 mentions)
Gateway system, by Thermo Fisher Scientific (2 mentions)
Glutathione s transferase tag, by Thermo Fisher Scientific (2 mentions)
Gateway cloning technology, by Thermo Fisher Scientific (2 mentions)
Ah109, by Takara Bio (2 mentions)
Lr clonase enzyme, by Thermo Fisher Scientific (2 mentions)
Quikchange lightning multi site directed mutagenesis kit, by Agilent Technologies (2 mentions)
Lsm 710, by Zeiss (2 mentions)
Lsm 780, by Zeiss (2 mentions)
Superscript 4 cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Veriti thermocycler, by Thermo Fisher Scientific (2 mentions)
Phusion polymerase master mix, by Thermo Fisher Scientific (2 mentions)
Bigdye terminator cycle sequencing kit v1, by Thermo Fisher Scientific (2 mentions)
3130xl genetic analyzer, by Thermo Fisher Scientific (2 mentions)
Pet53 dest expression vector, by Thermo Fisher Scientific (2 mentions)
68 protocols using pdonr221 vector
1
Cloning and Expression of hSpindly and hCENP-F
2
BiFC Assay in N. benthamiana
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The nYFP (N-terminal fragment of YFP) was amplified from the plasmid pSY736 using the primers attB1-SY736F and 736-R, fused with the SAP gene, and then inserted into the pDONR221 vector (Invitrogen). The cYFP was amplified from the plasmid pSY735 using the primers attB1-SY735F and 735-R, fused with PPD1 or PPD2, and then inserted into the pDONR221 vector (Invitrogen). nYFP-SAP, cYFP-PPD1 and cYFP-PPD2 were then cloned into the Gateway binary vector pGWB414 by LR reactions. nYFP-SAP, cYFP-PPD1 and cYFP-PPD2 constructs were transformed into Agrobacterium strains. Agrobacterium strains containing nYFP-SAP, cYFP-PPD1 and cYFP-PPD2 plasmids were collected by centrifugation and suspended in buffer (10 mM MES pH 5.6, 150 μM acetosyringone and 10 mM MgCl2). Agrobacterium strains were then mixed and co-infiltrated into N. benthamiana leaves. After infiltration, plants were grown for 50 h before observation. Fluorescence was detected using confocal microscopy (Zeiss LSM 710).
3
Cloning and Transformation of SWN Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The SWN gene without the stop codon was amplified by PCR and cloned into the pDONR221 vector (Invitrogen) by BP reaction according to the manufacturer’s instructions. The resulting transgene in the entry vector was sequenced to make sure that no mutation was introduced during PCR. The transgene was then transferred into the pEarlyGate 104 Gateway-compatible destination vector [78 (link)] by LR reaction, according to the manufacturer’s instructions, to make Pro35S:YFP-SWN. The construct was introduced into Agrobacterium tumefaciens GV3101, which was then used to transform swn-4 mutant plants using the floral dip method [79 (link)]. Transgenic plants were selected in MS agar media containing 50 μg/ml of Hygromycin B and allowed to grow in soil to maturity to yield seeds. PCR primers used in making the construct are listed in S2 Table .
4
Generating Diverse BiFC and BRET Constructs
5
Cloning and Expression of Mlp124357 and PDI-11
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The open reading frame (ORF) of Mlp124357 without the portion coding for its signal peptide was obtained from GenScript (Piscataway, NJ, USA). The PDI-11 coding sequence was amplified from Arabidopsis. Amplicons were inserted into the pDONR221 vector (Invitrogen, part of Thermo Fisher Scientific, Waltham, MA, USA) by BP recombination reactions and then into the plant expression vectors pB7FWG2 or pK7WG2 by LR recombination reactions using Gateway technology [30 (link)]. All the constructs were sequenced before transformation in Agrobacterium C58C1.
6
Overexpression of LHCSR1 in Arabidopsis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The fragment corresponding to LHCSR1 (Locus XM_024529130) was amplified from P. patens total cDNA obtained from 6-days-old plants grown on minimal medium, RNA was isolated using TRI Reagent® Protocol (T9424, Sigma-Aldrich) and cDNA was synthetized using M-MLV Reverse Transcriptase (M1302, Sigma-Aldrich) and Oligo(dT)23 (O4387, Sigma-Aldrich). Primers including attB sequences for the gateway technology (Invitrogen™) were designed to anneal 27 base pairs upstream of the ATG codon (PpLHCSR1attB1 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCAATCTCGAGCTTTTGCT-3′) and 107 base pairs downstream of the stop codon (PpLHCSR1attB 5′- GGGGACCACTTTGTACAAGAAAGCTGGGTCGACTGCGAATCAATCAGAA-3′). The PCR-product was first cloned in pDONR™221 Vector (12536-017, Invitrogen™) and then recombined into the pH7WG2 binary vector (Karimi et al. 2002 (link)) to make the 35S::lhcsr1 construct. The accuracy of the cloning was verified by DNA digestion and sequencing and the plasmid was transferred to Agrobacterium tumefaciens strain GV3101 (Zhang et al. 2006 (link)). A. thaliana plants were transformed by the floral dip method and transgenic plants were selected on Murashige-Skoog medium supplemented by hygromycin (25 mg L−1) and carbenicillin (100 mg L−1) (Clough and Bent 1998 (link)).
7
OsNAC15 Subcellular Localization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For subcellular localization, the CDS of OsNAC15 was cloned into the pDONR221 vector using the BP reaction (Invitrogen, Carlsbad, CA, USA) to generate an entry vector, then combined with a pCAMBIA1300-pUbi-GFP-3 × Flag binary vector using the LR reaction to generate the pUbi:OsNAC15-GFP-3 × Flag vector. The construct was transformed into the GV3101 strain (Biomed, Beijing, China) and infiltrated into 3-week-old tobacco leaves by Agrobacterium injection and incubated for 2–3 days. Meanwhile, the roots of the pUbi:OsNAC15-GFP-3 × Flag transgenic seedlings were harvested. The fluorescence of GFP was observed with a confocal laser scanning microscope (LSM 980; Zeiss, Oberkochen, Germany).
8
Lentiviral Vector Construction and Titration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The previously described pSMAL vector modified from the MA1 lentiviral vector to have a Gateway cassette and SFFV promoter was used as the backbone for all generated lentiviral vectors49 (link),50 (link). HIST1H3H WT/K27M and HIST1H3F WT/K27I with a C-terminal HA-tag and attB sites for Gateway cloning were generated using GeneArt™ DNA Strings Fragments (Life Technologies). Luciferase modified for human expression (Luc2) was amplified out of the pGL4.51[luc2/CMV/NEO] vector (Promega). Genes were cloned into the pDONR221 vector (Invitrogen) using BP Clonase (Invitrogen) and subsequently cloned into the pSMAL vector using LR Clonase (Invitrogen) as per the manufacturer’s instructions. Lentiviral particles were produced in 293FT cells (Life Technologies) as previously. Viral titer was determined by adding serial dilutions of the concentrated viral particles onto 8227 AML cells and the percentage of GFP+ cells was measured 96 h later by flow cytometry.
9
Overexpression and Promoter Analysis of AHP6
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For overexpression of AHP6, the 35S::AHP6 construct was generated using the GATEWAY system (Invitrogen). The AHP6 cDNA fragment was amplified by PCR using total RNA extracted from 7-day-old Arabidopsis roots. The pENTRY-AHP6 plasmid was generated by inserting the amplified cDNA fragments into the pDONR221 vector (Invitrogen) using the BP reaction. The pENTRY-AHP6 construct was then recombined into the modified pMDC plant binary vector carrying the 35S promoter through the LR reaction. For the AHP6::GUS construct, the AHP6 promoter (1877 bp) was isolated by PCR from Arabidopsis genomic DNA. This DNA fragment was inserted into the PstI/EcoRI-digested pCAMBIA vector containing β-glucuronidase (GUS) by the Gibson Assembly Cloning system (New England BioLabs). Both constructs were introduced into Arabidopsis Col-0 plants by the floral dip method.
10
Cloning and Expression of AtGSNOR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA isolated from wild type Arabidopsis leaves was used to produce cDNAs by SuperScript II Reverse transcriptase (Invitrogen, Carlsbad, CA, USA). For amplification of coding sequence of AtGSNOR for gateway cloning, the first PCR reaction was made using gene-specific primers (ADH2-ATG-for: 5′-ATGGCGACTCAAGGTCAG-3′; ADH2-TGA-rev: 5′-TCATTTGCTGGTATCGAGGAC-3′). Afterward, the second PCR reaction was performed to introduce recombination sequences (att) at the 5′- and 3′-end using the following primers (ADH2-GW-forward: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCGACTCAAGGTC-3′; ADH2-GW-reverse: 5′- GGGGACCACTTTGTACAAGAAAGCTGGGTCTCATTTGCTGGTATCGAG-3′). The resulting PCR products were cloned into pDONR221 vector (Invitrogen, Carlsbad, CA, USA) by recombination reaction using BP Clonase enzyme mixture according to the instructions of the manufacturer. After sequencing, the correct clone was transferred into the expression vector pDEST17 by recombination using LP Clonase enzyme mixture (Invitrogen, Carlsbad, CA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!