Vivaspin

Ultrafiltration was performed as previously described (Iki et al. 2010 (link)) using Vivaspin (molecular weight cutoff 10,000; GE Healthcare). Column purification was performed using PD SpinTrap G-25 (GE Healthcare). In vitro translation reaction mixtures (140 µL) were passed through columns preequilibrated with TR buffer (30 mM HEPES [pH 7.4], 80 mM KOAc, 1.8 mM MgCl₂, 2 mM DTT, 1 tablet/50 mL complete protease inhibitor [Roche]).

To obtain the crude extract, 4 g of infiltrated leaf tissue were thawed and homogenized in 30 ml of 20 mM Na-phosphate buffer pH 7.4 containing 500 mM NaCl, 20 mM imidazole, 5% (w/v) polyvinyl polypyrrolidone, and 1 mM phenylmethanesulfonyl fluoride using an Ultraturrax homogenizer at 4°C. The resulting homogenate was centrifuged at 27000 g for 20 min at 4°C. The clear supernatant was filtered through three layers of Miracloth (Calbiochem, United States) and was used as the crude extract.
To purify the recombinant OepGLU protein containing the C-terminal 6xHis tag motif, 30 ml of crude extract was loaded onto a 1-ml His GraviTrap column (GE Healthcare, United Kingdom), and OepGLU protein was eluted with 3 ml of 20 mM Na-phosphate pH 7.4 containing 500 mM NaCl and 500 mM imidazole. Remaining NaCl and imidazole were removed by means of a PD-10 column (GE Healthcare, United Kingdom). The enzymatic solution was concentrated in 30 kDa microcentrifuge filters Vivaspin^® (GE Healthcare, United Kingdom) at 2000 g and 4°C to a final volume of 250 μl. This purified and concentrated preparation was used for OepGLU biochemical characterization.

Geobucillus sp. 70PC53 was precultured on minimal requirement (MR) plate containing 1% CMC/glucose at 50 °C for 24 h. One single colony was transferred to MR medium containing 1 % CMC, and the culture was incubated at 50 °C overnight. The MR medium consisted of 1.4 g (NH₄)₂SO₄, 2.0 g KH₂PO₄, 0.34 g CaCl₂·2H₂O, 0.30 g MgSO₄·7H₂O, 5 mg FeSO₄·7H₂O, 1.6 mg MnSO₄·H₂O, 1.4 mg ZnSO₄·7H₂O, and 2.0 mg CoCl₂·6H₂O per liter. The cell density was determined by OD₆₀₀ absorbance and measured every 3 h for the first 12 h, and then 24 h to the fifth day. Cell pellet and culture medium were separated by centrifugation. Geobacillus cell pellet was pretreated with 1 mg/ml lysozyme for 1 h at room temperature, and the pellet (cytoplasm) was separated from the supernatant (peptidoglycan) by centrifugation. The pellet was re-suspended in 20 mM sodium phosphate (pH 7), and the crude protein was extracted by sonication. The culture medium was concentrated and buffer exchanged using a 10,000 MWCO Vivaspin (GE).

Seven‐day‐old seedlings cultured in the above‐mentioned liquid MS medium were heat‐shocked at 37°C for 30 min, blotted dry, and immediately frozen in liquid nitrogen. Approximately 25 g of frozen tissue was pulverized and resuspended at 55°C in extraction buffer (EXB; 100 mM Na₂HPO₄, 10 mM Tris–HCl, 300 mM NaCl, and 10 mM iodoacetamide [IAA]) and made 7 M guanidine‐HCl, 10 mM sodium metabisulfate, and 2 mM PMSF just before use (final pH 8.0) (Rytz et al., 2016 (link)). The extract was filtered through two layers of Miracloth (EMD Millipore), clarified by centrifugation at 15,000 g, and incubated overnight at 4°C with Ni‐NTA resin (Qiagen) (.75‐ml resin/5 g of tissue) after addition of imidazole to 10 mM. The Ni‐NTA beads were washed sequentially with 10 column volumes of EXB containing 6 M guanidine‐HCl, .25% Triton X‐100, and 10 mM imidazole (pH 8.0); 10 column volumes of EXB containing 8M urea, .25% TritonX‐100, and 10 mM imidazole (pH 6.8); and 15 column volumes of EXB containing 8 M urea, .25% Triton X‐100, and 10 mM imidazole (pH 8.0). SUMO conjugates were released with five column volumes of elution buffer containing 350 mM imidazole, 100 mM Na₂HPO₄, 10 mM Tris–HCl, and 10 mM IAA (pH 8.0). The eluant was concentrated by ultrafiltration with a 10‐kDa molecular mass cutoff filter (Vivaspin; GE Healthcare Life Sciences).

The hMSC CM was first concentrated using a 5‐kDa cutoff filter (Vivaspin; GE Healthcare Biosciences) according to manufacturer's guidelines, as previously described 35. Following this, a targeted proteomic analysis for VEGF, nerve growth factor, BDNF, interleukin‐6 (IL‐6), and GDNF was performed using a Bioplex‐Luminex assay. Samples were analyzed in a MAGPIX, Luminex's xMAP instrument (Luminex, Austin, TX, https://www.luminexcorp.com), and each factor concentration was calculated or obtained using Bioplex Manager version 6.1 software (Bio‐Rad Laboratories, Hercules, CA, http://www.bio‐rad.com), and expressed as picograms per milliliter.

Recombinant proteins were produced using the following primer sequences (CppA: cppA_pET-F: 5’- CCGGATCCAATGACTTTAATGGAAAATATTAC -3’ cppA_pET-R: 5’ CCGGATCCTTCATTTCGTAAACCATACTTC 3’, HVR: emm_pET-F: 5’- CCGGATCCAGGTTTTGCGAATCAAACAGAGGTTAAG -3’, emm_pET-R: 5’- CCGGATCCTAGCTCTCTTAAAATCTCTTCCTGCAACTTCC -3’, Aur: aur_pET-F: 5’- CGGGATCCGATTGATTCAAAAAATAAACC -3’ aur_pET-R: 5’- CGGGATCCTTACTCCACGCCTACTTCATTC) and the pET-19b overexpression system as previously described [49 (link)]. rCppA, rEmm 1.0 hypervariable region (HVR), rAur and the previously described rScpA fragment [49 (link)], truncated at amino acid 720 to prevent pro-peptide removal, were purified using the Ni-NTA purification system (Invitrogen) according to the manufacturer's instructions. Purified proteins were buffer-exchanged into PBS. Full-length rScpA was expressed following amplification from gDNA (scpA_pET-F: 5’- CCGGATCCAACCAAAACCCCACAAACTC-3’, scpA_pET-R: 5’- CCGGATCCTAGAGTGGCCCTCCAATAGC-3’), and purified from BL21 cell lysates by size exclusion chromatography using a 1 × 50 cm Econo-Column^® (Bio-Rad) packed with Sephadex G-100 (Pharmacia). PBS fractions containing ScpA were identified by SDS-PAGE, pooled and concentrated using a 30,000 MWCO spin column (Vivaspin, GE Healthcare).