Anti sirt3 antibody

Manufactured by Cell Signaling Technology

Sourced in United States

The Anti-SIRT3 antibody is a lab equipment product that detects the presence and levels of SIRT3 protein in biological samples. SIRT3 is a member of the sirtuin family of proteins, which play a role in cellular processes such as energy metabolism and oxidative stress response. The antibody can be used in various laboratory techniques, including Western blotting and immunohistochemistry, to study the expression and localization of SIRT3 in different cell and tissue types.

Automatically generated - may contain errors

Lab products found in correlation

Mitotracker green, by Thermo Fisher Scientific (2 mentions) Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions) Nitrocellulose membrane, by Merck Group (1 mentions) Ecl detection system, by Thermo Fisher Scientific (1 mentions) Primescript 1st strand cdna synthesis kit, by Takara Bio (1 mentions) Abi prism 7900ht, by Qiagen (1 mentions) Ripa buffer, by Merck Group (1 mentions) Bca assay kit, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Alexa fluor 594, by Thermo Fisher Scientific (1 mentions) Fluoview 2000, by Olympus (1 mentions) Anti sirt1 antibody, by Cell Signaling Technology (1 mentions) Anti sirt6 antibody, by Cell Signaling Technology (1 mentions) Sybr green, by Avantor (1 mentions) Las 3000 bioimaging analyzer, by Fujifilm (1 mentions) Anti β actin antibody, by Cell Signaling Technology (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions)

3 protocols using anti sirt3 antibody

Sirt3 Quantification in Cochlear Explants

Check if the same lab product or an alternative is used in the 5 most similar protocols

To examine the Sirt3 level, cochlear explants were lysed in RIPA buffer (Millipore, Temecula, CA, USA) supplemented with Complete Protease Inhibitor Cocktail, 2 mM PMSF, and 0.1% SDS. The protein concentration was measured using the BCA assay kit (Thermo Scientific, Rockford, IL, USA). Total protein (~30 μg) was separated by 10% SDS-PAGE and then transferred to 0.45 μm Nitrocellulose Membrane (Millipore). The membrane was blocked with TBST containing 5% non-fat milk, incubated with anti-SIRT3 antibody (1:100; Cell Signal Technology) at 4 °C overnight and then hybridized with appropriate HRP-conjugated secondary antibody at room temperature for 1 h. Protein signals were visualized using ECL detection system (Thermo Scientific). For qRT-PCR analysis (ABI Prism 7900HT) of Sirt3, total RNA was isolated by the RNeasy Mini Kit (Qiagen). And cDNA was synthesized from total RNA with PrimeScript 1st Strand cDNA Synthesis Kit (Takara). The primers used are 5′- gcggctctacacacagaacat- 3′ (forward) and 5′- caggtttcacaacgccagta - 3′ as (reverse). β-tubulin was used as a control.

Quan Y., Xia L., Shao J., Yin S., Cheng C.Y., Xia W, & Gao W.Q. (2015). Adjudin protects rodent cochlear hair cells against gentamicin ototoxicity via the SIRT3-ROS pathway. Scientific Reports, 5, 8181.

+ Open protocol

+ Expand

Immunocytochemical Analysis of SIRT3 Localization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were grown on eight-well
chamber slides, fixed with 4% PFA, permeabilized with 1% Triton X-100
for 30 min, and blocked with 20% Normal Goat Serum for 30 min. Subsequently,
they were incubated overnight with anti-SIRT3 antibody (1:100, Cell
Signaling, USA) at 4 °C. The next day, the primary antibody was
labeled with red-conjugated secondary antibody Alexa-Fluor 594 (1:400,
Thermo Fisher, USA) by incubation for 1 h. Mitotracker Green (Thermo
Fisher, USA) was used for labeling the mitochondria, and Hoechst was
used to visualize the nuclei. Both dyes were mixed and added to slides
for 15 min of incubation. Images were acquired by a confocal microscope
with z-stacks (Olympus, Fluoview 2000).

Velichkovska M., Surnar B., Nair M., Dhar S, & Toborek M. (2018). Targeted Mitochondrial COQ10 Delivery Attenuates Antiretroviral-Drug-Induced Senescence of Neural Progenitor Cells. Molecular Pharmaceutics, 16(2), 724-736.

+ Open protocol

+ Expand

Quantitative Analysis of Sirtuin Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Gene expression was assessed by measuring cell type-specific gene expression by qRT-PCR. For qRT-PCR, mRNA was isolated from CMCs using TRIZOL reagent (Invitrogen) and RNA quantity and purity were estimated by measuring absorbances at 260 and 280 nm using a Nanodrop spectrophotometer (Thermo scientific). Two μl of cDNA was used in a reaction mixture containing SYBR green (VWR) and oligo primers (Integrated DNA Technologies, Inc). The Pfkfb3 primers used for qRT-PCR are forward primer, GTG ACA GGG ACT TGT CAC TC; reverse primer, GCC ATG CCG ACA CAG GTA.
For Western blotting, protein from CMC lysates was applied to each lane of a 12.5% or 10.5–14% Bis–Tris-HCl gel and electrophoresed. The separated proteins were then electroblotted onto a PVDF membrane and immunoblotted as described [56 (link), 57 (link)]. The following antibodies were used for these studies: anti-Sirt1 antibody (Cell Signaling Technology; 2496S), anti-Sirt3 antibody (Cell Signaling Technology; 5490S), anti-Sirt6 antibody (Cell Signaling Technology; 12486S) and anti-β-actin antibody (Cell Signaling Technology; 12262S). Immunoreactive bands were detected using a Fuji LAS-3000 Bio Imaging analyzer after exposure to ECL detection reagent. Band intensities were quantified using TotalLab TL120 or ImageQuantTL software.

Mehra P., Guo Y., Nong Y., Lorkiewicz P., Nasr M., Li Q., Muthusamy S., Bradley J.A., Bhatnagar A., Wysoczynski M., Bolli R, & Hill B.G. (2018). Cardiac mesenchymal cells from diabetic mice are ineffective for cell therapy-mediated myocardial repair. Basic research in cardiology, 113(6), 46.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!